umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1583 [hlh-4::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx40 [cnd-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwIs19 [hlh-6::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1601 [hlh-8::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1556 [hlh-12::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.

wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.

Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.

yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081

B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.

Auxin-Inducible Degron (AID) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.

axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.

Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]

sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.

High zinc transcriptional activation - deficient (Zad-d). Avoid high zinc concentrations. [NOTE: this strain was previously described as hizr-1(am285); the correct allele name hizr-1(am286).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

qaIs3502[unc-119(+) + pie-1::YFP::lmn-1 + pie-1::CFP::H2B] Relative stable expression of YFP::LMN-1 when grown at 24C. Expression of CFP::H2B is silenced. qaIs3502 is presumably not on LG III. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaEx3504 [pie-1::GFP::emr-1 + unc-119(+)]. Maintain by picking WT. Stable expression of GFP::EMR-1 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaIs3507 [unc-119(+) + pie-1p::GFP::lem-2] WT. Stable expression of GFP::LEM-2 when grown at 20C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Commercial requests should be addressed to info@embl-em.de

qaEx6900 [ftn-1p::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

qaEx6901 [ftn-2p::pes-10::GFP::his + lin-15(+)]. Segregates WT and Muv. Maintain by picking WT.

qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.

ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459.