meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi1 [htp-3p::GFP::him-8 + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ieSi1 is prone to silencing; GFP might not be visible at lower magnifications. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Wynne DJ, et al. J Cell Biol. 2012 Jan 9;196(1):47-64.

Long. Mechanosensory Abnormal. [NOTE: originally described as carrying e1084, this strain actually carries the e75 allele. The lesion has been verified by sequence analysis. (11/26/2018)]

eIs2137 [sup-7(+) + Dm-hsp::lacZ] IV. lacZ expression induced by heat shock. Limited pattern (the pSHZ1 vector was originally designed for use in Drosophila, not C. elegans, and is not the best vector for expression of lacZ in the worm). This strain has predominantly historical value (as the first C. elegans strain shown to express a foreign gene). eIs2137 transgene is integrated and contains two plasmids: pAST (sup-7 amber suppressor), and pSHZ1 (lacZ driven by Drosophila heat shock promoter (S. Munro)).

Temperature sensitive. Sterile at 25C. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England-the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]

Paralyzed Unc. This strain carries a tightly linked mutation, che-3(ky1018), that changes Q1107 of che-3 to a stop codon. Reference: Larsch, et al. (2015) Cell Reports.

mup-1 is a two-fold arrest lethal, suppressed in this strain by dpy-10.

mup-1 is a two-fold arrest lethal, suppressed in this strain by dpy-10.

Wild type-slightly Unc. Tc1 pattern high copy; different from RW7000. Bergerac isolate obtained by S. Brenner from Brun group. Caenorhabditis elegans wild isolate. CB subclone of Bergerac N62 (Tc1 pattern HCB). To obtain ECA243, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.

Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1; pattern III. Caenorhabditis elegans wild isolate. CB subclone of GA-12 (Tc1 pattern III). To obtain ECA245, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.

NOTE: Whole-genome analysis indicates that this stock is genotypically CB4858. Users interested in this strain are encouraged to obtain a verified CB4855-derivied strain. To obtain ECA247, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org. Isolated from compost in Palo Alto, CA in 1982(?). Wild type (plg-1(e2001)). Low copy Tc1, pattern VI. Caenorhabditis elegans wild isolate CB subclone of Sta-5 (Tc1 pattern VI). Original stock isolated by T. Doniach.

Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.

Isolated from Caltech flowerbed in the summer of 1971 (1973??) in Pasadena, CA. Wild type. Low copy Tc1; pattern XI. Caenorhabditis elegans wild isolate. EM subclone of PA1 (Tc1 pattern XI). To obtain ECA251, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.

Male-female strain. Reference WBG 9(3) 121. Isolated from sugar cane in Trinidad by D.J. Hunt (Commonwealth Institute of Parasitology). [7/7/93: Scott Baird and David Fitch question whether this strain is really C. remanei.] [7/95: Not cross-fertile with the authentic C. remanei isolated by Walter Sudhaus.] Previously called C. remanei by the CGC. Walter Sudhaus has tentatively described this strain as Caenorhabditis sp.; this description is not offical and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

This strain was grown on CeMM (C. elegans Maintenance Medium) for 3 years (called CC1). It was then flown on STS-107, shuttle Columbia (and now called CC3).

Dominant, gain-of-function mutation in egl-30; missense M244I. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Gln to Stop mutation in residue 205. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Gla. May contain dam-1(op241) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

ep369 is a weak allele. ep6 is a deletion allele. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Resistant to radiation-induced apoptosis (Dam); non-Gla; very weak Rad; no gross phenotype. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Missense mutation E158K. Worms are Egl-c, Eat, and loopy-Unc. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

epIs14 [sbp-1p::GFP + rol-6(su1006)]. Rollers. sbp-1 previously known as pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are Unc. Segregates DpyUncs. Segregates Uncs which are recessive Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Weak Egl. Rollers. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.

epEx141 [sbp-1::GFP::SBP-1 + rol-6(su1006)]. ep79 is a strong allele of sbp-1 (ts lethal). sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Weak sbp-1 allele. sbp-1 aka pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. NOTE: This strain carries an unknown GFP marker.

Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).

Isolated in 1991 by Carlos E. Winter in soil samples taken at the University of Sao Paulo in Brazil. Hermaphrodite strain. Adults are 1.5mm. The life cycle is a little longer than C. elegans at 22C. Each lays about 300 eggs in the three days following the moult from L4 to adult. Eggs are laid just after being fertilized resulting sometimes in plates with many eggs (much more than C. elegans). See Comp. Biochem. Physiol 103B: 189, 1992. See Nematology 2(1): 89-98, 2000. Can be grown and maintained on NGM. L1s easily frozen and stored in liquid nitrogen. This strain is deposited in Paul Sternberg's collection under the name PS1022. The species has not yet been determined; Lynn Carta will publish a paper proposing Oscheius brevesophaga. DO NOT use this name before the paper is published. Contact Carles E. Winter or Lynn Carta before publishing anything official about this strain. See also WBPaper00004471 and WBPaper00004485. AKA Oscheius sp. 1.

muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]

muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.

Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.