More Fields
Strain Species Genotype
ZT61 C. elegans vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT63 C. elegans csr-1(fj150) IV. Show Description
RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT64 C. elegans csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT65 C. elegans him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT69 C. elegans csr-1(fj162) ?; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT72 C. elegans dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT73 C. elegans coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZW127 C. elegans zwIs106. Show Description
zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).
ZW129 C. elegans unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
ZW281 C. elegans lin-15B&lin-15A(n765) X; zwEx101. Show Description
zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW282 C. elegans lin-15B&lin-15A(n765) X; zwEx102. Show Description
zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW283 C. elegans lin-15B&lin-15A(n765) X; zwEx103. Show Description
zwEx103 [inx-3p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW284 C. elegans lin-15B&lin-15A(n765) X; zwEx104. Show Description
zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW285 C. elegans lin-15B&lin-15A(n765) X; zwEx105. Show Description
zwEx105 [inx-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW286 C. elegans lin-15B&lin-15A(n765) X; zwEx106. Show Description
zwEx106 [inx-6p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW287 C. elegans lin-15B&lin-15A(n765) X; zwEx107. Show Description
zwEx107 [inx-7p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW288 C. elegans lin-15B&lin-15A(n765) X; zwEx108. Show Description
zwEx108 [inx-8p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW289 C. elegans lin-15B&lin-15A(n765) X; zwEx109. Show Description
zwEx109 [inx-9p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW290 C. elegans lin-15B&lin-15A(n765) X; zwEx110. Show Description
zwEx110 [inx-10p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW291 C. elegans lin-15B&lin-15A(n765) X; zwEx111. Show Description
zwEx111 [inx-11p:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW292 C. elegans lin-15B&lin-15A(n765) X; zwEx112. Show Description
zwEx112 [inx-12p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW293 C. elegans lin-15B&lin-15A(n765) X; zwEx113. Show Description
zwEx113 [inx-13p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW294 C. elegans lin-15B&lin-15A(n765) X; zwEx114. Show Description
zwEx114 [inx-14p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW295 C. elegans lin-15B&lin-15A(n765) X; zwEx115. Show Description
zwEx115 [inx-15p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW296 C. elegans lin-15B&lin-15A(n765) X; zwEx116. Show Description
zwEx116 [inx-16p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW297 C. elegans lin-15B&lin-15A(n765) X; zwEx117. Show Description
zwEx117 [inx-17p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW298 C. elegans lin-15B&lin-15A(n765) X; zwEx118. Show Description
zwEx118 [inx-18p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW299 C. elegans lin-15B&lin-15A(n765) X; zwEx119. Show Description
zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW300 C. elegans lin-15B&lin-15A(n765) X; zwEx120. Show Description
zwEx120 [inx-20p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW301 C. elegans lin-15B&lin-15A(n765) X; zwEx121. Show Description
zwEx121 [inx-21p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW302 C. elegans lin-15B&lin-15A(n765) X; zwEx122. Show Description
zwEx122 [inx-22p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW303 C. elegans lin-15B&lin-15A(n765) X; zwEx123. Show Description
zwEx123 [eat-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW304 C. elegans lin-15B&lin-15A(n765) X; zwEx124. Show Description
zwEx124 [unc-7ap:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW477 C. elegans bkip-1(zw10) II. Show Description
Increased angle of head bending. Maintain under normal conditions. Reference: Chen B, et al. J Neurosci. 2010 Dec 8;30(49):16651-61.
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.
ZW64 C. elegans unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
ZX2604 C. elegans sng-1(ok234) X; zxIs127. Show Description
zxIs127 [sng-1p::SNG-1::CRY2olig(535) + myo-2p::mCherry]. Strain should be kept in the dark; it is very light-sensitive. Pan-neuronal expression of a truncated variant of Arabidopsis thaliana Cryptochrome-2 fused to synaptogyrin. If illuminated with blue light, synaptic vesicles cluster, resulting in inhibition of synaptic transmission. Synaptic transmission is restored within 15 minutes in the absence of light (ca. 6.5min time constant), resulting in normal wild type behavior afterwards. Reference: Vettkotter D, et al. Nat Commun 13, 7827 (2022). https://doi.org/10.1038/s41467-022-35324-z. PMID: 36535932
ZX299 C. elegans lin-15B&lin-15A(n765) X; zxEx22. Show Description
zxEx22 [myo-3p::ChR2(H134R)::YFP + lin-15(+)].
ZX388 C. elegans lin-15B&lin-15A(n765) X; zxIs3. Show Description
zxIs3 [unc-47p::ChR2(H134R)::YFP + lin-15(+)]. Strain occasionally segregrates Muv animals; pick non-Muv animals to maintain.
ZX398 C. elegans lin-15B&lin-15A(n765) X; zxEx32. Show Description
zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].
ZX422 C. elegans lin-15B&lin-15A(n765) X; zxEx33. Show Description
zxEx33 [unc-17p::NpHR::eCFP + lin-15(+)].
ZX460 C. elegans zxIs6 V. Show Description
zxIs6 [unc-17p::ChR2(H134R)::YFP + lin-15(+)] V.
ZX679 C. elegans zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX819 C. elegans lite-1(ce314); zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX899 C. elegans lite-1(ce314) X; ljIs123; zxEx621. Show Description
ljIs123 [mec-4p::ChR2(H134R)::YFP(codon-optimized) + unc-122p::RFP]. zxEx621 [glr-1p::Mac::mCherry + elt-2p::GFP]. Pick animals with robust GFP expression in intestinal nuclei to maintain.
ZZ1 C. elegans lev-11(x1) I. Show Description
Levamisole resistant. Twitcher.
ZZ1004 C. elegans unc-63(x18) dpy-5(e61) I. Show Description
ZZ1012 C. elegans unc-74(x19) dpy-5(e61) I. Show Description
ZZ1015 C. elegans unc-38(x20) dpy-5(e61) I. Show Description
ZZ12 C. elegans lev-11(x12) I. Show Description
Levamisole resistant twitcher. Weakly semi-dominant. M-MATING++ 1-10%WT.