VM484 |
C. elegans |
akIs3 V. Show Description
akIs3 [nmr-1::GFP + lin-15(+)] V.
|
|
VM487 |
C. elegans |
nmr-1(ak4) II. Show Description
Fewer spontaneous reversals. Required for NMDA gated currents.
|
|
VM57 |
C. elegans |
lin-15B&lin-15A(n765) X; akEx16. Show Description
akEx16 [glr-3::GFP + lin-15(+)]. Maintain by picking non-Muv. Worms with the array are non-Muv at 20C.
|
|
VM763 |
C. elegans |
lin-15B&lin-15A(n765) X; akEx130. Show Description
akEx130 [(pPB45) glr-1::GFP + (pJM23) lin-15(+)]. Worms with the array are non-Muv at 20C.
|
|
VP198 |
C. elegans |
kbIs5. Show Description
kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.
|
|
VP303 |
C. elegans |
rde-1(ne219) V; kbIs7. Show Description
kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.
|
|
VP596 |
C. elegans |
dvIs19 III; vsIs33 V. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).
|
|
VPR108 |
C. elegans |
vprIs108. Show Description
vprIs108 [hlh-17p::GCaMP2.0 + hlh-17p::mCherry]. Variably penetrant backward ventral coiler. GCaMP2.0 green fluorescence is normally very low. Reference: Stout RF, Parpura V., Cell Calcium. 2011 Jul;50(1):98-108.
|
|
VPR120 |
C. elegans |
vprEx120. Show Description
vprEx120 [dat-1p::DsRed(monomeric)]. Maintain by picking DsRed+ animals.
|
|
VPR127 |
C. elegans |
vprIs127. Show Description
vprIs127 [hlh-17p::GFP]. Unc, backward ventral coiler.
|
|
VPR128 |
C. elegans |
vprIs128. Show Description
vprIs128 [hlh-17p::DsRedExpress2]. Unc, backward ventral coiler.
|
|
VPR133 |
C. elegans |
vprEx133. Show Description
vprEx133 [hlh-17p::dat-1p::DsRedExpress2]. DsRed2 expression is driven only by downstream (dat-1) promoter.
|
|
VPR156 |
C. elegans |
vprIs156. Show Description
vprIs156 [hlh-17p::DsRed(monomeric)]. Unc, backward coiler.
|
|
VPR157 |
C. elegans |
vprIs157. Show Description
vprIs157 [hlh-17p::GFP]. Unc, backward ventral coiler.
|
|
VPR160 |
C. elegans |
vprEx160. Show Description
vprEx160 [hlh-17p::empty vector + unc-54p::mCherry]. Maintain by picking mCherry+. Unc, backward coiler.
|
|
VPR163 |
C. elegans |
vprEx163. Show Description
vprEx163 [unc-54p::mCherry]. Maintain by picking mCherry+.
|
|
VPR168 |
C. elegans |
wyEx915. Show Description
wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.
|
|
VPR839 |
C. elegans |
unc-119(ed4) III; irIs67. Show Description
irIs67 [hlh-17p::GFP + unc-119(+)].
|
|
VS15 |
C. elegans |
hjIs8. Show Description
hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.
|
|
VS17 |
C. elegans |
hjIs9. Show Description
hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
VS18 |
C. elegans |
maoc-1(hj13) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
VS19 |
C. elegans |
maoc-1(hj14) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
VS20 |
C. elegans |
hjIs67. Show Description
hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
VS21 |
C. elegans |
hjSi20 IV. Show Description
hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.
|
|
VS22 |
C. elegans |
saeg-1(hj12) V. Show Description
Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.
|
|
VS23 |
C. elegans |
saeg-2(hj9) III. Show Description
Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.
|
|
VS24 |
C. elegans |
kat-1(tm1037) II. Show Description
Reference: Nat Genet. 2006 Mar;38(3):363-8.
|
|
VS26 |
C. elegans |
rde-10(hj20) I. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
|
|
VS27 |
C. elegans |
rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
|
|
VS8 |
C. elegans |
dhs-28(hj8) X. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
|
|
VT1064 |
C. elegans |
mir-48(n4097) maIs105 V; mir-84(n4037) X. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.
|
|
VT1066 |
C. elegans |
nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1072 |
C. elegans |
unc-119(ed3) III; maIs134. Show Description
maIs134 [lin-4p::GFP + unc-119(+)]. Wild type.
|
|
VT1102 |
C. elegans |
lin-28(n719) I; lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1103 |
C. elegans |
lin-28(n719) I; nDf51 V; mir-84(n4037) X. Show Description
Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1113 |
C. elegans |
unc-119(ed3) III; maIs135. Show Description
maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.
|
|
VT1142 |
C. elegans |
nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1143 |
C. elegans |
lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1145 |
C. elegans |
lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1146 |
C. elegans |
nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1153 |
C. elegans |
unc-119(ed3) III; maIs137. Show Description
maIs137 [let-7p::GFP + unc-119(+)]. Wild type.
|
|
VT1160 |
C. elegans |
unc-119(ed3) III; maIs138. Show Description
maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.
|
|
VT1189 |
C. elegans |
unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
|
|
VT1259 |
C. elegans |
unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
|
|
VT1289 |
C. elegans |
mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
VT132 |
C. elegans |
sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
|
|
VT1343 |
C. elegans |
flh-1(bc374) IV. Show Description
|
|
VT1361 |
C. elegans |
mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
VT1362 |
C. elegans |
mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
VT1376 |
C. elegans |
flh-2(bc375) III. Show Description
|
|