More Fields
Strain Species Genotype
VPR157 C. elegans vprIs157. Show Description
vprIs157 [hlh-17p::GFP]. Unc, backward ventral coiler.
VPR160 C. elegans vprEx160. Show Description
vprEx160 [hlh-17p::empty vector + unc-54p::mCherry]. Maintain by picking mCherry+. Unc, backward coiler.
VPR163 C. elegans vprEx163. Show Description
vprEx163 [unc-54p::mCherry]. Maintain by picking mCherry+.
VPR168 C. elegans wyEx915. Show Description
wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.
VPR839 C. elegans unc-119(ed4) III; irIs67. Show Description
irIs67 [hlh-17p::GFP + unc-119(+)].
VS15 C. elegans hjIs8. Show Description
hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.
VS17 C. elegans hjIs9. Show Description
hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS18 C. elegans maoc-1(hj13) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS19 C. elegans maoc-1(hj14) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS20 C. elegans hjIs67. Show Description
hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS21 C. elegans hjSi20 IV. Show Description
hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.
VS22 C. elegans saeg-1(hj12) V. Show Description
Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.
VS23 C. elegans saeg-2(hj9) III. Show Description
Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.
VS24 C. elegans kat-1(tm1037) II. Show Description
Reference: Nat Genet. 2006 Mar;38(3):363-8.
VS26 C. elegans rde-10(hj20) I. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS27 C. elegans rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS8 C. elegans dhs-28(hj8) X. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VT1064 C. elegans mir-48(n4097) maIs105 V; mir-84(n4037) X. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.
VT1066 C. elegans nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1072 C. elegans unc-119(ed3) III; maIs134. Show Description
maIs134 [lin-4p::GFP + unc-119(+)]. Wild type.
VT1102 C. elegans lin-28(n719) I; lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1103 C. elegans lin-28(n719) I; nDf51 V; mir-84(n4037) X. Show Description
Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1113 C. elegans unc-119(ed3) III; maIs135. Show Description
maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.
VT1142 C. elegans nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1143 C. elegans lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1145 C. elegans lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1146 C. elegans nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1153 C. elegans unc-119(ed3) III; maIs137. Show Description
maIs137 [let-7p::GFP + unc-119(+)]. Wild type.
VT1160 C. elegans unc-119(ed3) III; maIs138. Show Description
maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.
VT1189 C. elegans unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
VT1259 C. elegans unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
VT1289 C. elegans mir-63(n4568) X. Show Description
Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT132 C. elegans sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
VT1343 C. elegans flh-1(bc374) IV. Show Description
VT1361 C. elegans mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1362 C. elegans mir-70(n4109) V. Show Description
Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VT1376 C. elegans flh-2(bc375) III. Show Description
VT1379 C. elegans unc-119(ed3) III; maIs162. Show Description
maIs162 [mir-59p::GFP + unc-119(+)]. Wild type.
VT1380 C. elegans unc-119(ed3) III; maIs163. Show Description
maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type. [10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]
VT1470 C. elegans unc-119(ed3) III; maIs173. Show Description
maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.
VT1474 C. elegans unc-119(ed3) III; maIs177. Show Description
maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.
VT1477 C. elegans unc-119(ed3) III; maIs180. Show Description
maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.
VT1479 C. elegans unc-119(ed3) III; maIs182. Show Description
maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.
VT1481 C. elegans unc-119(ed3) III; maIs184. Show Description
maIs184 [mir-51::GFP + unc-119(+)]. Wild type.
VT1482 C. elegans unc-119(ed3) III; maIs185. Show Description
maIs185 [mir-2p::GFP + unc-119(+)]. Wild type.
VT1485 C. elegans unc-119(ed3) III; maIs188. Show Description
maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.
VT1486 C. elegans unc-119(ed3) III; maIs189. Show Description
maIs189 [mir-54-56p::GFP + unc-119(+)]. Wild type.
VT1488 C. elegans unc-119(ed3) III; maIs191. Show Description
maIs191 [mir-235p::GFP + unc-119(+)]. Wild type.
VT1492 C. elegans unc-119(ed3) III; maIs196. Show Description
maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.
VT1494 C. elegans unc-119(ed3) III; maIs197. Show Description
maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.