Search Strains

staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.

hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.

sybIs6766 [ges-1p::TurboID-ER::unc-54 3’UTR + myo-2p::mCherry::unc-54 3’UTR + pha-1(+)]. Integrated strain expressing TurboID in the intestine localized and retained in the ER. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx11 [ges-1p::F21A3.11::2xLinker::WormScarlet::SL2WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F21A3.11 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx19 [ges-1p::F53B6.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F53B6.4 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx23 [ges-1p::(delta SP)F21A3.11::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Non-secreted F21A3.11 tagged with WormScarlet to visualize the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx13 [ges-1p::T05E12.3::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. T05E12.3 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx17 [ges-1p::F56F10.1::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F56F10.1 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx15 [ges-1p::C02A12.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. C02A12.4 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

sybIs7982 [ges-1p::TurboID::unc-54 3’UTR + myo-2p::mCherry::unc-54 3’UTR + pha-1(+)]. Integrated strain expressing TurboID in the intestine cytoplasm. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56.

staEx27 [ges-1p::F21A3.11::3xHA::tag::SL2WormScarlet::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Overexpression of F21A3.11 with a 3xHA tag. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

staEx28 [ges-1p::F21A3.11(7A)::3xHA::tag::SL2WormScarlet::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. Overexpression of phosphatase-dead form of F21A3.11 carrying seven point mutations and a 3xHA tag. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.

wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3'UTR + pha-1(+)]. Pan-neuronal expression of nuclear-localized GCaMP6s. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

wtfEx48 [rab-3p::Chrimson::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for animals carrying the array. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of Chrimson. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.

eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896.

ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

ljfSi32 [egl-20 enhancer(-1261 – 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.

acEx102 [vha-6p::pmk-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: (2010) J Bio Chem 285(14):10832-40.

acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.

acEx187 [vha-6p::nhr-8::SL2::GFP + rol-6(su1006)]. Pick Rollers to maintain (GFP expression in intestine is easy to see and might be easier to score than Rol). Intestinal rescue of nhr-8(ok186) mutants. Reference: Otarigho B & Aballay A. 2020. iScience. 2020 May 22;23(5):101068. doi: 10.1016/j.isci.2020.101068. PMID: 32361270.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+ and segregate wild-type mKate2+, very few non-mKate arrested larvae (bon145 homozygotes mostly Emb), Vul mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type mKate2+. bcl-11(bon172) is a CRISPR/Cas9-engineered deletion causing truncation of BCL-11 lacking ∼196 amino acids and carrying a predicted triple HA sequence (3xHA) at the C terminus. Genotyping primers: Fw GTGAGCTTGCTGAGCCAGCT and Rev CGGGTAAGAGAAGATTGAGCGCAA; bcl-11(bon172): ~250 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102.

Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.

Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible AID-1* and HA tag inserted into the endogenous hrde-1 locus. GFP fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible AID* and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.

qpIs11 [vha-1p::GFP + unc-119(+)] I. Strong expression of GFP in the cytoplasm of the excretory canal cell (exc) and slightly less strong expression in the head mesodermal cell (hmc). Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72.

inIs179 [ida-1p::GFP]. GFP is expressed in a subset of neurons and the neuroendocrine uv1 cells of the vulva. Identified neurons include ADE, ALA, ASI, ASK, AUA, ASG, AVH, AVJ, AVK, VC, HSN, PDE, PVP, PHA, PHB, PHC. Male sex-specific neurons include CA and some ray neurons. Plasmid pida-1::GFP 7.6 was injected into N2 and integrated to generate BL5715, then crossed into him-8(e1489) background.

byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.

byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .

Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.] For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

rgEx81[pha-1(+) + unc-103 promoter E::unc-103 genomic DNA]. Maintain at 20C.

rgEx235 [plc-3p::YFP + pha-1(+)]. Expresses YFP from a 4.4bk upstream plc-3 promoter. Maintain at 20C.

rgEx251[pha-1(+) + osm-12 promoter:: unc-103(gf)]. Maintain at 20C.

The hemaglutinin (HA) epitope tag was inserted using CRISPR/Cas9 through homologous recombination. The nine amino acid HA epitope was placed between C. remanei (EM464) MSS-1 residues 22 and 23, one residue downstream of the predicted mature N-terminus after signal peptide cleavage. NOTE: nm74 was originally described as nmIs9. Derived from parental strain SB146. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.

nm77 is an HA epitope tag inserted into the endogenous Cbr-msrp-3 locus, two codons after the predicted signal peptide cleavage site of Cbr-MSRP-3. Anti-HA antibodies recognize the tagged Cbr-MSRP-3 glycoprotein on immunoblots, in the membranous organelles of spermatids, and on the plasma membrane of activated sperm (including pseudopod) in both males and hermaphrodites. To confirm presence of the nm77 insertion, use primers AT19+AT20 (WT: 291 nt, nm77: 318 nt). AT19: AAGAAGAGAGAAACCAGAAGC. AT20: AAAAGTAAAACATACCGATCACA. Reference: Van Goor J, et al. Curr Biol. 2025 35:1-7.

qcEx53 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.

qcIs59 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Small Rollers. GFP::SMA-3 fusion protein is expressed in the intestine. Derivative of a strain described in Wang et al., 2002, Development 129:4989-4998.

neIs9 [myo-3p::HA::rde-1 + rol-6(su1006)] X. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. Rollers. RDE-1 activity is rescued in the body-wall muscle, making animals RNAi-deficient except for body-wall muscle cells. Derived by crossing parental strains WM118 and LIU1. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.

dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.

Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well.

Deformed pharynx.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.