More Fields
Strain Species Genotype
ZM7765 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM8874 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3371. Show Description
hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9442 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3373. Show Description
hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9443 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3507. Show Description
hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9519 C. elegans flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9583 C. elegans unc-2(hp858) X. Show Description
GFP tag inserted at the N-terminus (immediately in front of the ATG start codon) of the unc-2 locus specifically tagging the UNC-2B isoform. hp858 animals exhibit wildtype motor behaviors. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.
ZU279 C. elegans unc-119(ed3) III; czIs110. Show Description
czIs110 [mex-5p::GFP::KDEL::pie-1 3’UTR + unc-119(+)]. GFP::KDEL is a marker of the luminal ER in the embryo. Reference: Lee et al., J Cell Biol. 2016 Sep 12;214(6):665-76.
ZW127 C. elegans zwIs106. Show Description
zwIs106 contains [unc-9p::GFP + lin-15(+)]. Superficially wild-type. Maintain under normal conditions. Described in Altun et al. Dev Dyn 238:1936-50 (2009).
ZW129 C. elegans unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
ZW281 C. elegans lin-15B&lin-15A(n765) X; zwEx101. Show Description
zwEx101 [inx-1p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW282 C. elegans lin-15B&lin-15A(n765) X; zwEx102. Show Description
zwEx102 [inx-2p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW283 C. elegans lin-15B&lin-15A(n765) X; zwEx103. Show Description
zwEx103 [inx-3p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW284 C. elegans lin-15B&lin-15A(n765) X; zwEx104. Show Description
zwEx104 [inx-4p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW285 C. elegans lin-15B&lin-15A(n765) X; zwEx105. Show Description
zwEx105 [inx-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Maintain under normal conditions. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW286 C. elegans lin-15B&lin-15A(n765) X; zwEx106. Show Description
zwEx106 [inx-6p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW287 C. elegans lin-15B&lin-15A(n765) X; zwEx107. Show Description
zwEx107 [inx-7p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW288 C. elegans lin-15B&lin-15A(n765) X; zwEx108. Show Description
zwEx108 [inx-8p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW289 C. elegans lin-15B&lin-15A(n765) X; zwEx109. Show Description
zwEx109 [inx-9p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW290 C. elegans lin-15B&lin-15A(n765) X; zwEx110. Show Description
zwEx110 [inx-10p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW291 C. elegans lin-15B&lin-15A(n765) X; zwEx111. Show Description
zwEx111 [inx-11p:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW292 C. elegans lin-15B&lin-15A(n765) X; zwEx112. Show Description
zwEx112 [inx-12p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW293 C. elegans lin-15B&lin-15A(n765) X; zwEx113. Show Description
zwEx113 [inx-13p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW294 C. elegans lin-15B&lin-15A(n765) X; zwEx114. Show Description
zwEx114 [inx-14p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW295 C. elegans lin-15B&lin-15A(n765) X; zwEx115. Show Description
zwEx115 [inx-15p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW296 C. elegans lin-15B&lin-15A(n765) X; zwEx116. Show Description
zwEx116 [inx-16p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW297 C. elegans lin-15B&lin-15A(n765) X; zwEx117. Show Description
zwEx117 [inx-17p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW298 C. elegans lin-15B&lin-15A(n765) X; zwEx118. Show Description
zwEx118 [inx-18p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW299 C. elegans lin-15B&lin-15A(n765) X; zwEx119. Show Description
zwEx119 [inx-19p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW300 C. elegans lin-15B&lin-15A(n765) X; zwEx120. Show Description
zwEx120 [inx-20p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW301 C. elegans lin-15B&lin-15A(n765) X; zwEx121. Show Description
zwEx121 [inx-21p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW302 C. elegans lin-15B&lin-15A(n765) X; zwEx122. Show Description
zwEx122 [inx-22p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW303 C. elegans lin-15B&lin-15A(n765) X; zwEx123. Show Description
zwEx123 [eat-5p::GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW304 C. elegans lin-15B&lin-15A(n765) X; zwEx124. Show Description
zwEx124 [unc-7ap:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.
ZW64 C. elegans unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
ZX679 C. elegans zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter. When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX819 C. elegans lite-1(ce314); zxIs12. Show Description
zxIs12 [F49H12.4P::ChR2(H134R)::mCherry + F49H12.4P::GFP]. Strain expresses Channelrhodopsin-2 (ChR2(H134R)::mCherry) and GFP (as marker) in PVD and AQR, as well as in a non-identified tail neuron, using the F49H12.4 promoter (see also ZX679). When grown in the presence of all-trans retinal and illuminated with blue light, animals show strong forward locomotion escape behavior, which can be quantified using locomotion video tracking. The strain can be used to analyze function of PVD cells, and to estimate the role of specific genes in the function of this polymodal nociceptor, downstream of depolarization via ChR2. All-trans retinal needs to be added with OP50 bacteria when seeding plates to render ChR2 functional. This strain is in lite-1(ce314) background, which eliminates the photophobic behavioral response that will be startled by blue light when longer light stimuli are used (>1s). To not confuse the photophobic behavior induced by LITE-1, with the PVD evoked escape behavior, this strain is needed for experiments with prolonged photostimulation. References: Husson S, et al. Curr Biol. 2012 May 8;22(9):743-52. Smith CJ, et al. Neuron. 2013 Jul 24;79(2):266-80. Cohen E, et al. Molecular and Cellular Neuroscience 2104 59C: 85-96.
ZX899 C. elegans lite-1(ce314) X; ljIs123; zxEx621. Show Description
ljIs123 [mec-4p::ChR2(H134R)::YFP(codon-optimized) + unc-122p::RFP]. zxEx621 [glr-1p::Mac::mCherry + elt-2p::GFP]. Pick animals with robust GFP expression in intestinal nuclei to maintain.
ZZY17 C. briggsae Cbr-unc-119(st20000) III; zzyIs17 V. Show Description
zzyIs17 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 6.9 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY25 C. briggsae Cbr-unc-119(st20000) III; zzyIs25 V. Show Description
zzyIs25 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 3.5 and 8.45 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY29 C. briggsae Cbr-unc-119(st20000) III; zzyIs29 IV. Show Description
zzyIs29 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.28 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY31 C. briggsae Cbr-unc-119(st20000) III; zzyIs31 IV. Show Description
zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY33 C. briggsae Cbr-unc-119(st20000) III; zzyIs34 X. Show Description
zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY37 C. briggsae Cbr-unc-119(st20000) III; zzyIs37 IV. Show Description
zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY43 C. briggsae Cbr-unc-119(st20000) III; zzyIs43 IV. Show Description
zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY49 C. briggsae Cbr-unc-119(st20000) III; zzyIs49 IV. Show Description
zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY64 C. briggsae Cbr-unc-119(st20000) III; zzyIs64 X. Show Description
zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY66 C. briggsae Cbr-unc-119(st20000) III; zzyIs66 V. Show Description
zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
CF4587 C. elegans muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249