wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. FLPon::GFP tag inserted into endogenous dma-1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into endogenous syd-2 locus with (517-836) region replaced by worm-optimized FUS 1-163. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs853 [ser-2(prom3)::mCherry::rab-7 + odr-1p::GFP] V. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs738 [ser-2(prom3)::dma-1:GFP + odr-1p::GFP] I. wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous syd-1 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLP::mScarlet-I tag inserted into endogenous unc-13 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. syd-2(wy1398) is a GFP tag inserted into endogenous syd-2 locus with SYD-2(517-539), SYD-2(617-655), and SYD-2(731-801) regions deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. syd-2(wy1292) is a CRISPR-engineered deletion of SYD-2(517-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. FLPon::GFP tag inserted into endogenous unc-44 locus, specifically tagging UNC-44L. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. dyn-1(wy1150) is a CRISPR-engineered point mutation creating a temperature-sensitive dynamin mutant. FLPon::GFP tag inserted into endogenous dma-1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. FLPon::GFP tag inserted into endogenous dma-1 locus with AP-2 binding motif (YFGI) deleted. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

clic-1(wy1357) = endogenous GFP-FLPon-CLIC-1. wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locusafter the DMA-1 transmembrane domain and before cytoplasmic tail. rab-7(wy1390) = endogenous GFP-FLPon-RAB-7. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locus after the DMA-1 transmembrane domain and before cytoplasmic tail. GFP::FLP tag inserted into endogenous rab-11.1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP::FLPon(FRT) tag inserted into endogenous rab-10 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. wy1220 is a CRISPR/Cas9-engineered hpo-30(R186A) substitution mutation in the furin cleavage site. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. mScarlet tag inserted into endogenous rab-10 locus. GFP tag inserted into endogenous dma-1 locus. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. mNG tags inserted into endogenous arx-2 and lam-2 loci. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

bmdSi339 [loxN::lin-29p::FLP::p2A::H2B::2xmTurq2] I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2] II. qyIs225 [cdh-3p::mCherry::moeABD] V. AID and mNG tags inserted into endogenous arx-2 locus. mNG tag inserted into endogenous lam-2 locus. Wild-type growth and movement. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04H4.7. External left primer: CCTAGTGTACTTCCGTATCCG. External right primer: GTGCAGCGACTTGATAGTGAG. Internal left primer: ATAGTCAGTGAGAGACGCTGG. Internal right primer: CCGCCTTCGATCGATTTTCTG. Internal WT amplicon: 2295 bp. Deletion size: 673 bp. Deletion left flank: CGCCTATAATATAAATCCAATAAAATTTGA. Deletion right flank: GTTGAACAAGTTTTAATAAAACCAATGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D10.6. External left primer: TCACGTGCTGGATCTACGTAG. External right primer: AATGGCTGGAGGGGTACATAG. Internal left primer: AATGGGACAGCCTGGCACCTC. Internal right primer: TCCGAGTTCGATCAGACTGGC. Internal WT amplicon: 2600 bp. Deletion size: 507 bp. Deletion left flank: GAGAAAGAGAGAGAGAACAAATTGTGAGAA. Deletion right flank: GCCAAAACCTAAGCCTAAGCATAAGCCTAA. Insertion Sequence: AGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07D10.6. External left primer: TCACGTGCTGGATCTACGTAG. External right primer: AATGGCTGGAGGGGTACATAG. Internal left primer: AATGGGACAGCCTGGCACCTC. Internal right primer: TCCGAGTTCGATCAGACTGGC. Internal WT amplicon: 2600 bp. Deletion size: 742 bp. Deletion left flank: TTTACGGGACATTGACACCCTTGATCCTAG. Deletion right flank: CTACAAATAATGGAGGAGGATGATGATGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07E11.3, W07E11.1. External left primer: GGGCGGGTTTCTAAAAAGTAAGTG. External right primer: TCGGTGTCTGGCTCAAGCATG. Internal left primer: GTTAACGGAAGAGGTGGGATC. Internal right primer: GGGCATCTCAACGACATGACG. Internal WT amplicon: 2724 bp. Deletion size: 2618 bp. Deletion left flank: ACGGAAGAGGTGGGATCTCTCGAAAAACCT. Deletion right flank: GTAGAGTGAACACAGATTGAGCACTTGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07E11.2. External left primer: CAGTTTCCACGCATTCATTG. External right primer: ATATCTCGGCGGTTCACAAC. Internal left primer: GAGCGAACCATGAAATTGTG. Internal right primer: GCGTAACACCACCATAACCA. Internal WT amplicon: 1113 bp. Deletion size: 457 bp. Deletion left flank: TTCTTTTGCCAAAGCGCATTGTGCCAAATG. Deletion right flank: TCATTTCATCAGCAATGGCTCGTTTGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK525.1. External left primer: GGCATAGCAGCAGACTAC. External right primer: CCTGAGTGTTGTGATTCC. Internal left primer: TCACACAAACCCGTTACC. Internal right primer: GGTTGCCAAGACCCGAAG. Internal WT amplicon: 2040 bp. Deletion size: 708 bp. Deletion left flank: TTGCCGAAATTGCCGATTTTCATTCAAGGA. Deletion right flank: AAAAAGCAATCAAACCGTTTGAGATATAAA. Insertion Sequence: AAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W07E11.3. External left primer: TCAACTCTCACACAGCCCAC. External right primer: ATTTTCAGGTACACACCCGC. Internal left primer: GTTGGTTGAGATGCCACCTT. Internal right primer: CACAGAGCTTTCGTCTGACTC. Internal WT amplicon: 1219 bp. Deletion size: 372 bp. Deletion left flank: TTCCAAATATGTGTTTGGGTTTTAAGCTTG. Deletion right flank: CGACAATTGGTTTGGCAACGACTGACAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3015) in R173.4, detectable by PCR using the following primers. External left primer: AAAAGGATCCGAAAGGAGGA. External right primer: GCGTGTTACTGTACGCGAAA. Internal left primer: TTGCTCCTCCTTCCACACTT. Internal right primer: GGAAAGGGGGAAGTTGACTC. Internal WT amplicon: 1628 bp. Deletion size: 665 bp. Deletion left flank: ATCATTGAAATTCTTCACGAGAAACAATTG. Deletion right flank: CAACCAGTGCCTTCCGACTTCCATTCCAGG. Validation: gk3015 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3123) in C03G5.7, detectable by PCR using the following primers. External left primer: CCTTCTATTCCCCCAGAGGCTTAC. External right primer: CGTTTGTCACCACTTCCCTATCC. Internal left primer: GGGTCGTGTGACGAATTGCGC. Internal right primer: AACCGTAATAGAAGACAGGGAGGTG. Internal WT amplicon: 3658 bp. Deletion size: 1513 bp. Deletion left flank: ACAGAAAAAAAAACACAAAAAACCAAAACT. Deletion right flank: TGGGTTAGTATTTCAAGAAAATAATTTTTT. Validation: gk3123 passed by CGH. Other deletion (gk3259) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H2.1. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1201 homozygotes (variable arrest, at least some animals persist to sterile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGTTTCCTTTTGAGCAG. External right primer: ATCCACTTGGGTTTCGTTTG. Internal left primer: TTCCGGAAACCGCATATTAG. Internal right primer: TTACGCAATGCACACACTGA. Internal WT amplicon: 2028 bp. Deletion size: 471 bp. Deletion left flank: TCAGCAAAATGGATGAGATTTGGAAAGCGT. Deletion right flank: TTTTTGAAGATCAAAGCGAAATAAGACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 713 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTGGAAAAATTTGTTTTTTCGTAGATA; Right flanking sequence: AGGTGATGCAGCAGACAGATGTCACACTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 272 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTCAGACTCCGCCCATACGTGTGCTCTCCA; Right flanking sequence: AGGTTCAACTTTTTCGAAAAACGAACAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

wpIs40 [unc-47p::mCherry] V. ynIs50 [flp-22p::GFP]. AVL neurons are labeled with GFP and mCherry. Can be used to isolate AVL by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wpIs39 [unc-47p:mCherry] X. otIs92 [flp-10::GFP]. DVB neurons are marked with GFP and mCherry. Can be used to isolate DVB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

LoxP::SL2::H1::mCherry::FLP::FRT::myo-2::GFP::Hyg::LoxP was inserted at the 3' end of the endogenous nhr-67 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. Transgenic animals have pharyngeal RFP expression and SNB-1::GFP expression in AVA (soma and along the VNC).

hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. Slow forward and backward movement, with reduced reversals.

hpIs721 [rig-3p::FRT::Stop::FRT::snb-1::GFP + nmr-1p::FLP::FLP + myo-2p::RFP]. hpIs811 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::Cherry + twk-40p(short)::Cre]. Transgenic animals have pharyngeal RFP signal; GFP puncta are visible in AVA soma but not along the VNC; RFP signals along AVA neurite.

hpIs824 [flp-18p::LoxP::eBFP::Stop::LoxP::gtACR2::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA soma and neurites of the VNC. Activation of gtACR2 inhibits both forward and backward movement.