| DG4230 |
C. elegans |
gla-3a(tn1734[gfp::3xflag::gla-3a]) I. Show Description
Superficially wild type
|
|
| DG4233 |
C. elegans |
pqn-59(tn1737[gfp::3xflag::pqn-59]) I. Show Description
Superficially wild type
|
|
| DG4269 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I. Show Description
Superficially wild type
|
|
| DG4324 |
C. elegans |
pod-2(tn1765[gfp::3xflag::pod-2]) II. Show Description
Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
|
|
| DG4392 |
C. elegans |
cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
|
|
| DG4569 |
C. elegans |
cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051.
doi: 10.1093/genetics/iyac051. PMID: 35377419
|
|
| DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| DQM1152 |
C. elegans |
bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID*) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
|
|
| DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
|
|
| DQM984 |
C. elegans |
bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
| DV3089 |
C. elegans |
rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790.
|
|
| DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
| DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’
HS126 5’-TTGTCCTCCTCTCCCTTGG-3’
HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3402 |
C. elegans |
ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background.
TD185 5’ -GCCGGAAGAGTGATGAACCC- 3’
TD186 5’ -TAATGAGCTCGGAGACCATGGC- 3’
TD187 5’ -CGCACCTCATCATACATGAACTGC- 3’
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3651 |
C. elegans |
his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) X. Show Description
mTurqoise2 tag with linker sequence inserted into endogenous his-72 locus. mNeonGreen::2xFLAG tag inserted into endogenous yap-1 locus. Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells, deficiency of wts-1 (Warts/LATS) causes translocation into nuclei of all cell types observed. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
|
|
| DV3670 |
C. elegans |
rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. Show Description
AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.
|
|
| DV4012 |
C. elegans |
rap-2(re346[mKate2::3xFLAG::rap-2]) V. Show Description
mKate2::3xFLAG tag inserted into endogenous rap-2 locus. Ubiquitous red expression, plasma membrane with some cytosolic localization. Reference: Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816.
|
|
| DV4186 |
C. elegans |
his-72(erb77[his-72::linker::mTurquoise2]) III; yap-1(re269[yap-1::mNeonGreen::2xFLAG]) reDf4 X. Show Description
Mild uncharacterized Unc. reDf4 is a deletion of the tandemly duplicated cst-1 and cst-2 loci as well as intervening ncRNAs.
Ubiquitous yellow fluorescence (488 nm or 514 nm) is cytosolic with modest nuclear signal and strong exclusion from nucleoli, but translocates to nuclei upon disruption of upstream Hippo pathway components. Deficiency of cst-1/2 (Hippo/MST) causes translocation into nuclei of all hypodermal cells. YAP-1::mNG::2xFLAG may be non-functional, as endogenous tag blocks lethality conferred by deficiency of WTS-1. References: Huynh L, et al. BioRxiv. 2025 Aug 29:2025.08.22.671798. doi: 10.1101/2025.08.22.671798. PMID: 40909657. Sloan DE & Bembenek JN. MicroPubl Biol. 2021 Sep 29:2021:10.17912/micropub.biology.000471. PMID: 34604717.
|
|
| DZ710 |
C. elegans |
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
|
|
| DZ840 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
|
|
| DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
| EGD615 |
C.elegans |
cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
|
|
| EL610 |
C. elegans |
smrc-1(om143[3xflag::smrc-1]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
|
|
| EL629 |
C. elegans |
cid-1(om148[cid-1::3xmyc]) pup-2(om147[3xflag::pup-2]) II. Show Description
3xMyc tag inserted at C-terminus of endogenous cid-1 locus using CRISPR/Cas9. cid-1 also known as pup-1. 3xFlag tag inserted at N-terminus of endogenous pup-2 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
|
|
| EL634 |
C. elegans |
met-2(om142 [3xflag::met-2]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.
|
|
| EL658 |
C. elegans |
smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
|
|
| EL662 |
C. elegans |
pup-3(om150[3xflag::pup-3]) I. Show Description
3xFlag tag inserted at N-terminus of endogenous pup-3 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
|
|
| EL663 |
C. elegans |
smrc-1(om144[3xmyc::smrc-1]) met-2(om142[3xflag::met-2]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
|
|
| EL716 |
C. elegans |
pup-4(om151[pup-4::3xflag]) II. Show Description
3xFlag tag inserted at C-terminus of endogenous pup-4/F43E2.1 locus using CRISPR/Cas9. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
|
|
| ERT529 |
C. elegans |
unc-119(ed3) III; jySi40. Show Description
jySi40 [vha-6p::NANOLUC::3xFLAG::unc-54 3' UTR + Cbr-unc-119(+)]. Can be used as a Nanoluciferase (NanoLuc) expressing control for luminescence in Promega NanoGlow Assays. Reference: Sfarcic I, et al. Genetics. 2019 Dec;213(4):1197-1207. doi: 10.1534/genetics.119.302655. PMID: 31585955.
|
|
| EV343 |
C. elegans |
unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
|
|
| EV484 |
C. elegans |
efIs155 II. Show Description
efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3′UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644
|
|
| FGP29 |
C. elegans |
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
| FGP30 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
| GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GLW33 |
C. elegans |
T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|
| GLW35 |
C. elegans |
gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
|
|
| GLW39 |
C. elegans |
ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
|
|
| GLW41 |
C. elegans |
nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
|
|
| GLW43 |
C. elegans |
edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
|
|
| GLW45 |
C. elegans |
ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
|
|
| GLW47 |
C. elegans |
hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
|
|
| GLW51 |
C. elegans |
cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
|
|
| GLW57 |
C. elegans |
asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
|
|
| GLW63 |
C. elegans |
pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
|
|