More Fields
Strain Species Genotype
WBM1340 C. elegans wbmIs99 IV. Show Description
wbmIs99 [rab-3p::3xFLAG::rpl-22::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs89] IV. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs89. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1344 C. elegans rpl-22(wbm58[3xFLAG::rpl-22]) II. Show Description
3xFlag tag inserted at N-temrinus of endogenous rpl-22 locus. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments.
WBM1364 C. elegans wbmIs119 V. Show Description
wbmIs119 [eft-3p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs88] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in soma. wrmScarlet expression in soma. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs88. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1470 C. elegans wbmIs131 V. Show Description
wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WBM1471 C. elegans wbmIs133 V. Show Description
wbmIs133 [rab-3p::3XFLAG::rpl-22::SL2::scarlet::rab-3 3'UTR, *wbmIs127] (V:8645000). N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the nervous system. wrmScarlet expression in nervous system. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs127. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433
WJA1004 C. elegans unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.
WJA1097 C. elegans rps-10(srf0825[K125R]) rps-20(srf1046[K6R+K9R]) unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Nuclear body wall muscle GFP+.
WJA1190 C. elegans rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WM192 C. elegans unc-119(ed3) III; neIs21. Show Description
neIs21 [wago-1::3xFLAG + unc-119(+)]. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM193 C. elegans csr-1(tm892) IV; neIs20. Show Description
neIs20 [pie-1::3xFLAG::csr-1 + unc-119(+)]. Partially rescues sterility (60% dead embryos). Unknown if unc-119(ed3) is still present in the background. Reference: Claycomb J, et al. 2009 Cell 139:123-34.
WM274 C. elegans prg-1(tm872) I; neSi14 II; unc-119(ed3) III. Show Description
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WM275 C. elegans prg-1(tm872) I; neSi15 II; unc-119(ed3) III. Show Description
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WU1756 C. elegans lst-1(am302[3xFLAG::lst-1]) I. Show Description
Non-Glp; remains fertile even with sygl-1(RNAi). Endogenous lst-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 5-6 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).
WU1770 C. elegans sygl-1(am307[3xFLAG::sygl-1]) I. Show Description
Non-Glp; remains fertile even with lst-1(RNAi). Endogenous sygl-1 locus tagged with a 3xFLAG N-terminally. Visible in cytoplasm of 10-12 cell diameters of distal germline in young adults. Reference: Kocsisova Z, et al. Development. 2019 Apr 23;146(8).
WU1854 C. elegans pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.
YL390 C. elegans unc-119(ed3) III; vrIs48. Show Description
vrIs48 [pie-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL398 C. elegans unc-119(ed3) III; vrIs55. Show Description
vrIs55 [ges-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL402 C. elegans unc-119(ed3) III; vrIs56. Show Description
vrIs56 [pie-1p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL409 C. elegans unc-119(ed3) III; vrIs60. Show Description
vrIs60 [lin-35p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YL416 C. elegans unc-119(ed3) III; vrIs64. Show Description
vrIs64 [ges-1p::hpl-2::GFP::FLAG::hpl-2 3'UTR + unc-119(+)].
YL418 C. elegans unc-119(ed3) III; vrIs65. Show Description
vrIs65 [ges-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL424 C. elegans unc-119(ed3) III; vrIs68. Show Description
vrIs68 [efl-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL425 C. elegans unc-119(ed3) III; vrIs69. Show Description
vrIs69 [dpl-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL445 C. elegans unc-119(ed3) III; vrIs81. Show Description
vrIs81 [pie-1p::efl-1::GFP::FLAG::efl-1 3'UTR + unc-119(+)].
YL448 C. elegans unc-119(ed3) III; vrIs83. Show Description
vrIs83 [ges-1p::dpl-1::GFP::FLAG::dpl-1 3'UTR + unc-119(+)].
YL468 C. elegans unc-119(ed3) III; vrIs93. Show Description
vrIs93 [mex-5p::lin-35::GFP::FLAG::lin-35 3'UTR + unc-119(+)].
YY1325 C. elegans wago-4(gg620[3xflag::gfp::wago-4]) II. Show Description
3xflag::gfp inserted into endogenous wago-4 locus using CRISPR/Cas9 engineering. 3xFLAG::GFP::WAGO-4 is partially functional in this strain. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY1492 C. elegans mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY178 C. elegans ggIs1. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: GuangS, et al. Nature. 2010 Jun 24;465(7301):1097-101.
YY346 C. elegans nrde-2(gg91) II; ggIs28. Show Description
ggIs28 [nrde-3p::3xFlag::GFP::nrde-2 ORF + unc-119(+)]. Unknown if unc-119 is still in background. Reference: Burkhart KB, et al. PLoS Genet. 2011 Aug;7(8):e1002249.
YY916 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II. Show Description
GFP tag inserted at the N-terminus of endogenous znfx-1 via CRISPR/Cas9. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
YY968 C. elegans znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV. Show Description
3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
ZT22 C. elegans fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT24 C. elegans vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
GN517 C. elegans pgEx116. Show Description
pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.
GN600 C. elegans pgIs22 IV; oxIs95. Show Description
pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.