More Fields
Strain Species Genotype
JH2801 C. elegans unc-119(ed3) III; axIs1965. Show Description
axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2932 C. elegans unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3247 C. elegans meg-4(ax2080[meg-4::FLAG]) X. Show Description
C-terminal FLAG insertion in endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
JH4072 C. elegans pgl-3(ax4517[pgl-3::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JH4073 C. elegans pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JJ2286 C. elegans unc-119(ed3) III; zuIs263. Show Description
zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2586 C. elegans cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Show Description
cox-4(zu476[cox-4::eGFP::3xFLAG]) I. Endogenous cox-4 locus tagged with eGFP via genome editing. Mitochondria in all cell types are labeled with GFP. Reference: Raiders SA, et al. PLoS Genet. 2018 Jul 19;14(7):e1007417.
JK4626 C. elegans cku-80(ok861) unc-119(ed3) III; qIs170. Show Description
qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Jeong J, Verheyden JM, Kimble J. PLoS Genet. 2011 Mar;7(3):e1001348.
JK4871 C. elegans fog-3(q520) I; qSi41 II. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK4942 C. elegans sygl-1(tm5040) I; qSi49 II; unc-119(ed3) III. Show Description
qSi49 [sygl-1p::3xFLAG::sygl-1::sygl-1 3’UTR + unc-119(+)]. Superficially wild-type. Unknown whether or not unc-119(ed3) is still present in the background. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK4996 C. elegans lst-1(ok814) I; qSi69 II; unc-119(ed3) III Show Description
qSi69 [lst-1p::lst-1::3xFLAG::lst-1 3’UTR + unc-119(+)]. Superficially wild-type. Reference: Shin H, et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5028 C. elegans qSi77 II; unc-119(ed3) III. Show Description
qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5200 C. elegans fog-1(q785) fog-3(q520) I; qSi41 II; qSi140 IV. Show Description
qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.
JK5500 C. elegans sygl-1(q828) I; qSi150 II. Show Description
qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5758 C. elegans lst-1(q895[lst-1(long)::3xFLAG]) I. Show Description
3xFLAG tag inserted at the C terminus of the endogenous lst-1 locus, after V398 of the long isoform. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5932 C. elegans sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5942 C. elegans fog-3(q873[fog-3::3xFLAG]) I; qSi375 II. Show Description
q873[fog-3(1-262)::GGS::3xFLAG::fog-3(263 Phe)] I. qSi375 [mex-5p::eGFP::linker::his-58::3xboxb::tbb-2 3’UTR] II. The tethering assay allows this strain to be used for determining FOG-3 levels in different genetic backgrounds. Similar fertility to N2 wild type. Reference: Aoki S, et al. Cell Rep. 2018 Jun.26; 23(13):3769-3775
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JLF104 C. elegans zyg-9(wow12[ZF::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF145 C. elegans zif-1(gk117) III; air-1(wow14[air-1::ZF::GFP::3xFLAG]) V. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged AIR-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF212 C. elegans par-6(wow31[par-6::ZF::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged PAR-6 protein to be degraded. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.
JLF238 C. elegans tpxl-1(wow34[ZF::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. GFP expression is observed in microtubules. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged TPXL-1 protein to be degraded. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF302 C. elegans ebp-2(wow47[ebp-2::GFP::3xFLAG]) II; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF348 C. elegans mzt-1(wow51[GFP::3xFLAG::mzt-1]) I; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous mzt-1 locus. No overt phenotypes. GFP fluorescence is observed at microtubule-organizing centers. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF361 C. elegans spd-5(wow52[GFP:3xFlag:spd-5]) I. Show Description
GFP and 3xFLAG tags inserted into endogenous spd-5 locus. No overt phenotypes. GFP fluorescence is observed at centrosomes and ciliary base. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF425 C. elegans spd-5(wow36[tagRFP-T::spd-5]) spd-2(wow60[spd-2::GFP::3xFlag]) I. Show Description
tagRFP-T tag inserted into endogenous spd-5 locus. GFP and 3xFLAG tags inserted into endogenous spd-2 locus. No overt phenotypes. GFP and RFP fluorescence is observed at centrosomes. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JMC101 C. elegans csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JMC135 C. elegans vsra-1(tor94[GFP::3xFLAG::vsra-1] I. Show Description
GFP and 3xFLAG tags inserted into endgonenous vsra-1/C04F12.1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC151 C. elegans csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JMC201 C. elegans alg-1(tor137[GFP::3xFLAG::alg-1b]) X. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-1 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC203 C. elegans alg-2(tor139[GFP::3xFLAG::alg-2b]) II. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC205 C. elegans alg-3(tor141[GFP::3xFLAG::alg-3]) IV. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-3 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
JMC207 C. elegans alg-4(tor143[GFP::3xFLAG::alg-4]) III. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-4 locus. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
JMC209 C. elegans alg-5(tor145[GFP::3xFLAG::alg-5]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-5 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC211 C. elegans ergo-1(tor147[GFP::3xFLAG::ergo-1a]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC213 C. elegans prg-1(tor149[GFP::3xFLAG::prg-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous prg-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC217 C. elegans rde-1(tor153[GFP::3xFLAG::rde-1]) V. Show Description
GFP and 3xFLAG tags inserted into endgonenous rde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC219 C. elegans wago-1(tor113[GFP::3xFLAG::wago-1]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous wago-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC221 C. elegans ppw-2(tor115[GFP::3xFLAG::ppw-2]) I. Show Description
GFP and 3xFLAG tags inserted into endgonenous ppw-2 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013