Caenorhabditis Genetics Center (CGC)

Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ABR291 C. elegans pha-1(cc1299) III; staEx19. Show Description
staEx19 [ges-1p::F53B6.4::2xLinker::WormScarlet::SL2::WormGreenLantern::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for array. F53B6.4 tagged with WormScarlet to visualize secretion of the protein. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.
ABR489 C. elegans F53B6.4(sta15) I. Show Description
sta15 is a CRISPR-engineered 31bp deletion in exon 2 of F53B6.4 that causes in early stop codons and a predicted full knockout. Made with a co-conversion of dpy-10 in parental N2 strain; presumably chased away during out-crossing. Left flanking Sequence of the deletion: AATCATCAAAGTCTTCGAAATCGAAGAAAG ; Right flanking sequence of the deletion: TTCAACTGTTTCCGCTGCTACTGGTGTTTC . sgRNA #1: GTCAAGACTGCTACCACCTC. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.
PHX9731 C. elegans F53B6.4(syb9731[F53B6.4::3xHA]) I. Show Description
3xHA tag inserted into the C-terminus of the endogenous F53B6.4 locus. Insert: TACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCT. Wild type sequence with 30bp flanks: GAGATGATGGTTGTCCCATTGGTGGCTGCC*TAAacaatcgattcgacatcaatcttgaag. Knock-in with 30 bp flanks: GAGATGATGGTTGTCCCACTTGTGGCTGCCTACCCATACGACGTCCCAGACTACGCCTACCCATATGATGTCCCGGATTACGCTTACCCATACGATGTTCCAGATTACGCTTAAacaatcgattcgacatcaatcttgaag. Reference: Miklas JK, et al. Cell Rep. 2026 Aug 27;45(9):117902. doi: 10.1016/j.celrep.2026.117902. PMID: 42658673.