Homozygous viable. Deletion of 731 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATCGTCTTCAATCAGATTGATGTCAACA ; Right flanking sequence: CTTGGTTCTGGAATCCAATTTTCTTGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

wgIs386 [F21D5.9::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10845 [F21D5.9::H1-wCherry::let-858 3' UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.