More Fields
Strain Species Genotype
DM7339 C. elegans pha-1(e2123) III; raEx339. Show Description
raEx339 [T05G5.1p::D2092.4(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
RB1263 C. elegans acr-11(ok1345) I. Show Description
D2092.3 Homozygous. Outer Left Sequence: tctccaatccgtttgaatcc. Outer Right Sequence: aagtgtgtcgcagcccttat. Inner Left Sequence: ttttcggcattttgtcagtg. Inner Right Sequence: cgcagagtaatcaaccagca. Inner Primer PCR Length: 2967. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2329 C. elegans D2092.5(ok3165) I. Show Description
D2092.5. Homozygous. Outer Left Sequence: TGGCAGAATGTTGATGTGGT. Outer Right Sequence: TGGTGATAAAAAGAACGGGC. Inner Left Sequence: CAGAAGCAGTCTGAAACGGA. Inner Right Sequence: AACGAAAGGACGAGCGAATA. Inner Primer PCR Length: 1264 bp. Deletion Size: 972 bp. Deletion left flank: TGAACTCGTCGCTCCAATGATTTGATAGTG. Deletion right flank: CTGTTTCTGTTGTTTTTGTGAATTATTATT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3386 C. elegans D2092.10(ve886[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTATTTATCTGTGGCATTAGCTTTCACCA ; Right flanking sequence: CGGTAATGAGATATCCATTCTGTAAGTTGA. D2092.10 sgRNA A: ATTGAAAGAACTCGCTGAGT; D2092.10 sgRNA B: CTTATACTTCTCTCATTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.