RB2031 |
C. elegans |
D2005.1(ok2689) I. Show Description
D2005.1. Homozygous. Outer Left Sequence: TGCAAACTCCACCATTCTCA. Outer Right Sequence: AAGAAATTCAACGTGCCACC. Inner Left Sequence: TCGAAAGCAGCAAGAGTGAA. Inner Right Sequence: GATGACTGAATACTATCAAATACCT. Inner Primer PCR Length: 1124 bp. Deletion Size: 512 bp. Deletion left flank: ATGAGATATGCCCATATGCATTCTCATTTG. Deletion right flank: ACATTGCTCTGCGGGCAAGAATAATAGCAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
SHG2875 |
C. elegans |
D2005.4(ust638)[D2005.4::GFP::3xFlag] I. Show Description
GFP::3xFlag inserted into endogenous D2005.4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
|
|
VC1309 |
C. elegans |
nlp-8(ok1799) I. Show Description
D2005.2. Superficially wild type. External left primer: TCGGAAATGATTCATAGGGC. External right primer: TCACACCTCATACCCCCATT. Internal left primer: CTTTCAAATCACCCGACCAT. Internal right primer: TTCTTGATCTACCCGAACCG. Internal WT amplicon: 2229 bp. Deletion size: 695 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4214 |
C. elegans |
D2005.4(gk5300) I. Show Description
Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5300 mutation is G->A, flanking sequences AATCTTGATTTTAAATGCGAACGATTTTCA and GGCGAAGACTACAATGTGCAGCAGGCAAAA.
|
|
ZD2005 |
C. elegans |
eif-2Ba(qd335) III. Show Description
ZK1098.4. qd335 suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
|
|