OH4013 |
C. elegans |
otIs114 che-1(ot232) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
|
|
OH4027 |
C. elegans |
otIs114 I; fozi-1(ot234) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
|
|
OH4176 |
C. elegans |
otIs114 I; cog-1(ot242) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot242.
|
|
OH4974 |
C. elegans |
otIs114 I; lsy-12(ot89) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
|
|
OH707 |
C. elegans |
cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
|
|
OH8001 |
C. elegans |
otIs114 I; lsy-12(ot177) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Whole genome sequenced strain.
|
|
OQ192 |
C. elegans |
gmap-1(ulb13) X. Show Description
CRISPR/Cas9 engineered 1515 bp deletion of gmap-1; flanking sequences ACCTATCCAAAGCTT and TGCCAAGACATTGAA. Dessication sensitive. Shorter body length. Increased permeability of the cuticle. Reference: Ngale Njume F, et al. iScience. 2022 Oct 14;25(11):105357. doi: 10.1016/j.isci.2022.105357. PMID: 36339267.
|
|
PD2557 |
C. elegans |
rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
PD2558 |
C. elegans |
rpl-33(cc2558)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-33(cc2558) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (R9*). Presumptive rpl-33 null. Heterozygous rpl-33(cc2558)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
PD5994 |
C. elegans |
rps-23(cc5994)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by myo-2p::Venus-marked inversion. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus rps-23(cc5994) homozygotes (L1 arrest). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc5994 is an engineered mutation creating an early stop (A67*). Presumptive rps-23 null. Heterozygous rps-23(cc5994)/tmC5 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
PD5998 |
C. elegans |
rpl-5(cc5998)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-5(cc5998) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (A166*). Presumptive rpl-5 null. Heterozygous rpl-5(cc5998)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
|
|
PD6133 |
C. elegans |
tam-1(cc567) V. Show Description
Homozygotes have decreased expression of tandem array transgenes, descreased fertility and high incidences of males at 25C. Maintain strain at 16C.
|
|
PD6247 |
C. elegans |
tam-1(cc567) unc-46(e177) V. Show Description
Unc. Decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 16C.
|
|
PD6249 |
C. elegans |
ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
|
|
PHX293 |
C. elegans |
nas-38(syb293) X. Show Description
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
PHX3311 |
C. elegans |
casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
syb3311 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous casy-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Split-GFP tag inserted into endogenous casy-1 locus using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|
PHX3596 |
C. elegans |
tph-1(mg280) pah-1(syb3596) II. Show Description
Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
PHX3601 |
C elegans |
pah-1(syb3601) II. Show Description
Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.
|
|
PHX6153 |
C. elegans |
latd-1(syb6153[latd-1::GFP) X. Show Description
C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX6345 |
C. elegans |
W02D7.3(syb6345[GFP::W02D7.3]) V. Show Description
GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX6394 |
C. elegans |
Y71G12B.26(syb6394[Y71G12B.26::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX6466 |
C. elegans |
F36D1.23(syb6466[F36D1.23::tagRFP]) I. Show Description
tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX6541 |
C. elegans |
spex-2(syb6541[spex-2::SL2::GFP]) I. Show Description
GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
PHX700 |
C. elegans |
ilys-4(syb700) IV. Show Description
Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
|
|
PQ425 |
C. elegans |
apIs320 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
|
|
PQ426 |
C. elegans |
apIs404 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
|
|
PS1493 |
C. elegans |
dpy-20(e1362) IV; syIs9. Show Description
syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS4330 |
C. elegans |
spe-41(sy693) III; him-5(e1490) V. Show Description
Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PY7505 |
C. elegans |
oyIs84. Show Description
oyIs84 [gpa-4p::TU#813 + gcy-27p::TU#814 + gcy-27p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gpa-4 promoter and gcy-27 promoter, respectively. ASI is ablated in this strain. Increased dauer formation. Expression of dsRed in coelomocytes. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.
|
|
QC128 |
C. elegans |
paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
|
|
QC130 |
C. elegans |
paqr-3(ok2229) IV. Show Description
Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
|
|
QC155 |
C. elegans |
nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5-GAGATGAAAGATGTTGCTGTAGAA-3. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5-GTGCCTCCAGATCCACAGCT-3; mdt-15(et14) WT Fwd: 5-GTGCCTCCAGATCCACAGCC-3; mdt-15 Rev: 5-CACCCATTGGAGCACCACT-3. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
QC156 |
C. elegans |
acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5-GAGATGAAAGATGTTGCTGTAGAA-3. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5-GTGCCTCCAGATCCACAGCT-3; mdt-15(et14) WT Fwd: 5-GTGCCTCCAGATCCACAGCC-3; mdt-15 Rev: 5-CACCCATTGGAGCACCACT-3. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
QC158 |
C. elegans |
paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
|
|
QP1208 |
C. elegans |
sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
|
|
QQ250 |
C. elegans |
gin-1(cv10). Show Description
Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)
|
|
QQ255 |
C. elegans |
gsy-1(gk397885) II. Show Description
Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.
|
|
QQ257 |
C. elegans |
gin-2(cv11). Show Description
Gin is Glucose INtolerant. gin-2(cv11) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. 20C, Grown on HB101, HT115 or fresh OP50 (seeded less than five days).
|
|
RA454 |
C. elegans |
swsn-1(tm4567)/rol-9(sc148) V. Show Description
Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
RAF4 |
C. elegans |
cey-3(rrr11) cey-2(ok902) I. Show Description
Reduced brood size. cey-3(rrr11) was created using TALENs in the cey-2(ok902) mutant background to produce the double mutant. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.
|
|
RB2147 |
C. elegans |
acs-13(ok2861) I. Show Description
Y65B4BL.5. Homozygous. Outer Left Sequence: TATTCGGCTTTGAGGAGAGC. Outer Right Sequence: AAAGGCCACTGGTGAGTTTG. Inner Left Sequence: TGAACAAATGATTGAGCGACA. Inner Right Sequence: ACCGATGAGCTCAAAACGAC. Inner Primer PCR Length: 1131 bp. Deletion Size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RG3455 |
C. elegans |
mcm-2(ve955[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Late larval lethal. Deletion of 5085 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 animals that become increasingly unc and eventually die (ve955 homozygotes) and paralysed dpyunc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTGACATTCTCAATTCTCAATTGCTGAGCC; Right flanking sequence: CGCGATGGAGCGCGATTGCGCGGGCATGAC. mcm-2 sgRNA A: TTTTCGATGAATTCCGACTC; mcm-2 sgRNA B: ACAGAATTCAAAAGAGGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RM2576 |
C. elegans |
cho-1(tm373) IV. Show Description
Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
|
|
RM3571 |
C. elegans |
sup-1(e995 e2636) III. Show Description
Putative null allele; e995 e2636 homozygotes are superficially wild type in appearance, development, and behavior (except for a modest 20-25% decrease in swimming rate), and do not suppress unc-17(e245). e995 corresponds to G84E (gga>>gaa) and e2636 corresponds to W58stop (tgg>>tag). PCR methods for scoring e995 and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
|
|
RM523 |
C. elegans |
unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
|
|
RP1 |
C. elegans |
trIs10. Show Description
trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].
|
|
RW1522 |
C. elegans |
pat-2(st538) unc-32(e189) III; stEx10. Show Description
Animals with the extrachromosomal array are Unc Rollers. Animals which have lost the array are Pat. Strain can be propagated by chunking. The exact construct used to create stEx10 is unknown; it is thought to carry a pat-2 rescuing construct (most likely a cosmid) with a Rol marker.
|
|
SF1 |
C. elegans |
odc-1(pc13::Tc1) V. Show Description
Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.
|
|
SG1 |
C. elegans |
nrx-1(ds1) V. Show Description
Homozygous viable and fertile. No gross behavioral abnormalities. Reduction of thrashing rate and expulsions during defecation cycle. Changed sensitivity to compounds. Increased sensitivity to aldicarb and levamisole in paralysis tests. Reduced sensitivity during egg laying to levamisole, 5-hydrosxytryptamine, and imipramine. Morphological defects in neurite fasciculation, neurite branching, and synapse formation. 1.5bk deletion at the 5' end of the mRNA.
|
|
SJ4005 |
C. elegans |
zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock.
|
|