LSD1097 |
C. elegans |
smg-1(cc546) I; xchEx97. Show Description
xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
LSD2104 |
C. elegans |
xchIs15. Show Description
xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.
|
|
LW1288 |
C. elegans |
arIs37 I; sma-6(jj1) II; cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
|
|
LW2367 |
C. elegans |
arIs37 I; sma-9(cc604) X. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Tian et al. (2010) Development 137(14):2375-84.
|
|
LW557 |
C. elegans |
arIs37 I; fozi-1(cc607) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Missing M-derived coelomocytes and 1-3 body wall muscles. Cells transformed to sex myoblast-like fates. myo-3p::ssGFP is a secreted GFP that it taken up by coelomocytes.
|
|
LW614 |
C. elegans |
arIs37 I; sma-3(jj3) cup-5(ar465) III. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Small body size and 6 coelomocytes. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes.
|
|
MCJ11 |
C. elegans |
mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
MCJ180 |
C elegans |
mir-35(cdb2 cdb72) II. Show Description
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3 end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
|
|
MCJ191 |
C elegans |
mir-35(cdb2 cdb78) II. Show Description
cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3 end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
|
|
MCJ217 |
C. elegans |
mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
|
|
MH3084 |
C. elegans |
ain-2(tm1863) I; ain-1(ku322) X. Show Description
Double mutants displayed a severe defect in seam-cell development, implicating a retarded heterochronic phenotype. Protruding vulva phenotype. Increased number of seam cells. Reference: Zhang L, et al. Mol Cell. 2007 Nov 30;28(4):598-613. PMID: 18042455
|
|
MH4176 |
C. elegans |
ain-1(ku425) X. Show Description
Superficially wild-type. Identified in a screen for suppressors of the Multivulva (Muv) phenotype in lin-31 loss-of-function (lf) mutants. Reference: Ding L, et al. Mol Cell. 2005 Aug 19;19(4):437-47. PMID: 16109369.
|
|
ML2822 |
C. elegans |
unc-119(ed3) III; mcIs54 X. Show Description
mcIs54 [dpy-7p::spas-1::SL2(operon)::mCherry + unc-119(+)] X. Dpy. Expression of Spastin transgene depletes microtubules specifically in the hypodermis, creating a Dpy phenotype. Reference: Quintin S, et al. Development. 2016 Jan 1;143(1):160-73.
|
|
ML514 |
C. elegans |
che-14(ok193) I. Show Description
Animals are dye-filling negative. A bit sick with about 30% dying during larval development and the others displaying a number of defects in organs/tissues containing hypodermal cells (hypodermis, rectum, vulva, excretory system).
|
|
ML846 |
C. elegans |
vha-5(mc38) IV; mcEx337. Show Description
mcEx337 [vha-5(+)::GFP + rol-6(su1006)]. Animals with the array are Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
|
|
ML851 |
C. elegans |
vha-5(mc38) IV; mcEx342. Show Description
mcEx342[vha-5(E830Q)::GFP + rol-6(su1006)]. Animals with the array are slightly Dpy and are occasionally Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
|
|
MLC1774 |
C. elegans |
vha-11(luc130) IV. Show Description
vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1777 |
C. elegans |
vha-1(luc132) III. Show Description
vha-1 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1778 |
C. elegans |
vha-13(luc133) V. Show Description
vha-13 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1779 |
C. elegans |
vha-14(luc134) III. Show Description
vha-14 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1801 |
C. elegans |
vha-8(luc135) IV. Show Description
vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1843 |
C. elegans |
vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. Show Description
vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC1947 |
C. elegans |
dct-1(luc145) X. Show Description
dct-1 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) restriction sites. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC2364 |
C. elegans |
tbc-7(luc179) X. Show Description
tbc-7 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) and BamHI (GGATCC) restriction sites. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
MLC237 |
C. elegans |
mir-791(luc39) X. Show Description
luc39 is a deletion of mir-791. mir-791(luc39) mutants show a decreased turning and reversal rate compared to N2 animals under conditions where the CO2 concentration is gradually increased from 0-5%. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
MLC610 |
C. elegans |
cah-3(luc28[3' UTRmutant, delta mir-791 binding sites]) Show Description
luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
MLC657 |
C.elegans |
akap-1(luc37) III. Show Description
luc37 removes mir-791 binding sites in the akap-1 3'UTR. luc37 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals, similar to the response of mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
MQ1766 |
C. elegans |
sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.
|
|
MQ4 |
C. elegans |
mau-2(qm4) I. Show Description
Maternal effect uncoordinated. Egg-laying defective. Some larval lethality. Full zygotic rescue. Almost complete maternal rescue, no maternal rescue of egg-laying defect. Neuroanatomical defects. Short excretory canals.
|
|
MQ465 |
C. elegans |
mum-1(qm32) IV. Show Description
Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 32% of embyros die. 80% of larvae die. 100% of adult survivors show a mutant phenotype.
|
|
MQ467 |
C. elegans |
mum-3(qm46) III. Show Description
Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 15% of embyros die. 26% of larvae die. 100% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.
|
|
MQ470 |
C. elegans |
rop-1(pk93) V. Show Description
No visible phenotype. Severely decreased levels of the RoRNP-associated CeY RNA. Higher frequency of mutant 5S rRNA molecules into rop-1 ribosomes. See also WBPaper00003694.
|
|
MQ471 |
C. elegans |
mum-2(qm33) IV. Show Description
Variably deformed with no prominent single feature. Deformed pharynx. Very severly Unc: from strongly kinky to complete paralysis. Neuroanatomical defects. Abnormal excretory system. Abnormal gonads. 5% of embyros die. 54% of larvae die. 82% of adult survivors show a mutant phenotype.
|
|
MT152 |
C. elegans |
unc-53(n152) II. Show Description
Unc-cannot back. Egl. Males abnormal. Multiple defects in neuronal outgrowth and branching, also defects in excretory canal extension and in sex muscles migration. See also WBPaper00005353.
|
|
MT6984 |
C. elegans |
exc-9(n2669) IV. Show Description
Wide, meandering excretory canals, with some septate fluid-filled cysts. Canal enlargement visible from L1 through adult. Defect visible only by Nomarski microscopy. n2669 was originally listed as an allele of exc-5. Later repeated complementation tests showed n2669 to be an allele of a novel locus positioned close to exc-5.
|
|
N2 Male |
C. elegans |
C. elegans wild isolate. Show Description
C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.)
|
|
NC1469 |
C. elegans |
unc-119(ed3) III; wdEx575. Show Description
wdEx575 [ZC155.2::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expressed in cholinergic motor neurons, head & tail , neurons, and excretory cell. Construct made by Marc Vidal's group at Harvard as part of the promoterome project.
|
|
NC3292 |
C. elegans |
oig-1(wd114[oig-1::gfp11x7]) III. Show Description
Superficially wild-type. wd114 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous oig-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.
|
|
NC3381 |
C. elegans |
lev-10(wd116[lev-10::gfp11x7]) I. Show Description
wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.
|
|
NC3390 |
C. elegans |
oig-1(wd114[oig-1::gfp11x7]) III; wdEx1034. Show Description
wdEx1034 [rab-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd114 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous oig-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.
|
|
NC3492 |
C. elegans |
lev-10(wd116[lev-10::gfp11x7]) I; wdEx1086. Show Description
wdEx1086 [myo-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.
|
|
NC3493 |
C. elegans |
lev-10(wd116[lev-10::gfp11x7]) I; wdEx1087. Show Description
wdEx1087 [ttr-39p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.
|
|
NJ211 |
C. elegans |
can-1(rh67) III. Show Description
Shortened excretory canal.
|
|
NJ242 |
C. elegans |
exc-2(rh90) X. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.
|
|
NJ268 |
C. elegans |
pat-3(rh96) III. Show Description
Short excretory canal, incomplete QR, HSN migrations, post DTC loops.
|
|
NJ340 |
C. elegans |
exc-2(rh105) X. Show Description
Short swollen, bubbly excretory canal (resembles rh90).
|
|
NJ469 |
C. elegans |
exc-4(rh133) I. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.
|
|
NJ51 |
C. elegans |
exc-3(rh26) X. Show Description
Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips. 100% penetrant. Cysts often visible as clear spots by low-power microscopy.
|
|
NJ546 |
C. elegans |
unc-116(rh24) III; cat-6(e1861) V. Show Description
Paralyzed Unc. Abnormal excretory canal. Abnormal amphid sheath cell.
|
|
NJ555 |
C. elegans |
exc-3(rh207) X. Show Description
Excretory canal defect. Canals are shortened and animal is somewhat pale. Defect visible only by Nomarski microscopy. Tail spike is often malformed.
|
|