More Fields
Strain Species Genotype
CER554 C. elegans comt-4(cer157[comt-4p::GFP::H2B]) V. Show Description
No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CF2154 C. elegans tcer-1(tm1452) II; glp-1(e2141) III. Show Description
Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CF2167 C. elegans tcer-1(tm1452) II. Show Description
Temperature sensitive sterile at 25C. tcer-1(-) causes loss of germ cells and increases lifespan. Reference: Ghazi A, Henis-Korenbilt S, & Kenyon C (2009) PLoS Genet 5(9):e1000639.
CFJ302 C. elegans unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)
CL2008 C. elegans him-5 (e1490) V; dvIs3. Show Description
dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.
CL2179 C. elegans smg-1(cc546) I; dvIs179. Show Description
dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL4176 C. elegans smg-1(cc546) I; dvIs27 X. Show Description
dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by "chunking", which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CLP546 C. elegans twnEx185. Show Description
twnEx185 [mec-7p::MTS::roGFP + mec-7p::TOMM20::mCherry + ttx-3p::GFP]. Pick animals with GFP expression in head neurons (AIY) to maintain. roGFP can be used to monitor redox status of the mitochondrial matrix in the six touch receptor neurons: the oxidation-reduction status of mitochondrial matrix can be monitored with roGFP, a GFP variant that increases brightness in a more oxidized environment. The mitochondrial outer membrane in these neurons are marked by mCherry. Reference: Jiang HC, et al. Proc Natl Acad Sci USA. 2015 Jul 14;112(28):8768-73. doi: 10.1073/pnas.1501831112. PMID: 26124107. [NOTE: twnEx185 is incorrectly described as carrying myo-2p::GFP in the reference publication. The correct co-injection marker is ttx-3::GFP.]
COP1622 C. elegans nas-38(knu568) X. Show Description
Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP1635 C. elegans nas-38(knu579 ok3407) X. Show Description
Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP2412 C. elegans atg-9(ola511[delta AP]) V. Show Description
ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10.
CV385 C. elegans acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
CX12709 C. elegans avr-14(ad1302) I. Show Description
Decreased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12725 C. elegans inx-20(ok681) I. Show Description
Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX12726 C. elegans inx-9(ok1502) IV. Show Description
Increased locomotion on food. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CX14295 C. elegans pdfr-1(ok3425) III. Show Description
Decreased locomotion on food. Derived by outcrossing VC2609 five times to N2. Reference: Flavell SW, et al. Cell. 2013 Aug 29;154(5):1023-35.
CZ10123 C. elegans rabx-5(qa7800) III. Show Description
rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions
CZ20215 C. elegans tba-1(ju89) I. Show Description
Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.
CZ2274 C. elegans efn-4(bx80) efn-2(ev658) IV; efn-3(ev696) X. Show Description
bx80 was previously called mab-26(bx80): Extensive ray fusion involving all 9 rays; Larva have Vab phenotype with decreasing expressivity in adult; Hermaphrodites have swollen tail and anus. Vab, embryonic ventral enclosure defects, male ray fusions. Slow growth.
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
DA509 C. elegans unc-31(e928) IV. Show Description
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
DC1 C. elegans bah-1(br1) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
DC19 C. elegans bus-5(br19) X. Show Description
Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.
DC7 C. elegans bah-2(br7) IV. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
DG1856 C. elegans goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
DG4324 C. elegans pod-2(tn1765[gfp::3xflag::pod-2]) II. Show Description
Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
DH1370 C. elegans rme-6(b1014) X. Show Description
Accumulation of yolk GFP in pseudocoelom suggesting decrease or absence of coelomocyte mediated endocytosis. Abundant pseudocoelomic yolk.
DR2153 C. elegans rrf-3(b26) II; liv-4(m872) V. Show Description
Weak Unc (kinker) as adult. Increased life span. Maintain at 15C.
DR2168 C. elegans liv-2(m882) rrf-3(b26) II. Show Description
Approximately 30% dauer at 27C. Probably thermotolerant because it comes from a thermotolerant selection, but it was not retested. Increaesed longevity. Maintain at 15C.
DV3313 C. elegans rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
EA90 C. elegans pag-1(ls2) dpy-17(e164) III. Show Description
Dpy. pag-1(ls2) is recessive and has not visible phenotype by itself. It increases the expression of certain lacZ fusion genes such as lacZmec-7, unc-86lacZ and unc-4unc-76lacZ.
EC106 C. elegans eeEx106. Show Description
eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.
EG4322 C. elegans ttTi5605 II; unc-119(ed9) III. Show Description
Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]
EGD615 C.elegans cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
EM305 C. elegans efn-4(bx80) IV; him-5(e1490) V. Show Description
Extensive ray fusion involving all 9 rays. Larva have Vab phenotype with decreasing expressivity in adult. Hermaphrodites have swollen tail and anus. bx80 pka mab-26(bx80).
EN26 C. elegans lev-10(kr26::Mos1) I. Show Description
Weakly resistant to 1mM levamisole in acute screen. Animals become paralyzed after >30 min but nose remains hypercontracted. Sluggish Unc. pka lev-10.
FJ1519 C. elegans cdk-5(gm336) III. Show Description
cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.
FT1221 C. elegans unc-119(ed3) xnIs459 III. Show Description
xnIs459 [YFP::ral-1a + unc-119(+)] III. Expresses YFP::ral-1 maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1265 C. elegans sec-5(pk2358) II; xnIs461. Show Description
xnIs461 [sec-5::YFP + unc-119(+)]. Expresses sec-5::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Rescues maternal-effect lethality of sec-5(pk2358). Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1310 C. elegans avr-14(ad1302) I; xnSi31 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1370 C. elegans unc-119(ed3) III; xnIs484. Show Description
xnIs484 [mCherry::sec-10 + unc-119(+)]. Expresses mCherry::sec-10 maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1379 C. elegans avr-14(ad1302) I; xnSi34 II; unc-119 (ed3) III; glc-1(pk54::Tc1) avr-15(ad1051) V. Show Description
xnSi34 [sec-15::YFP + unc-119(+)] II. Expresses sec-15::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
FT1523 C. elegans sec-5(xn51[sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).
FT828 C. elegans unc-119(ed3) III; xnIs312. Show Description
xnIs312 [par-6p::par-6::mCherry + unc-119(+)]. Expresses par-6::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.
GA631 C. elegans lin-15B&lin-15A(n765) X; wuIs177. Show Description
wuIs177 [ftn-1p::GFP + lin-15(+)]. GFP expression in the intestine. ftn-1p::GFP transgene shows moderate basal expression under standard culture conditions in an otherwise wild-type background, but is strongly induced by reduced insulin/IGF-1 signalling, reduced HIF signalling, and increased free iron levels. References: Ackerman D & Gems D. PLoS Genet. 2012;8(3):e1002498. Valentini S, et al. Mech Ageing Dev. 2012 May;133(5):282-90.
GS1826 C. elegans dpy-20(e1282) IV; arIs36. Show Description
arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS1912 C. elegans arIs37 I; dpy-20(e1282) IV. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. GFP is secreted from muscle cells. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS7637 C. elegans cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter.
GS7638 C. elegans exc-6(gk386) cyk-1(or596) III; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.
GS7960 C. elegans exc-6(gk386) cyk-1(or596) III; inft-2(ok1296) V; arIs198. Show Description
Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.