sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.

sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.

sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.

wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.

wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228

fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

zzyIs17 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 6.9 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs25 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 3.5 and 8.45 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs29 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.28 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.

zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.