Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
WBM1438 C. elegans ieSi57 raga-1(wbm40[raga-1::AID*::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
WM242 C. elegans neSi12 II; unc-119(ed3) III. Show Description
neSi12 [cdk-1::GFP + Cbr-unc-119(+)] II. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
WM274 C. elegans prg-1(tm872) I; neSi14 II; unc-119(ed3) III. Show Description
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WM275 C. elegans prg-1(tm872) I; neSi15 II; unc-119(ed3) III. Show Description
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WRM1 C. elegans sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM10 C. elegans sprSi10 II; unc-119(ed3) III. Show Description
sprSi10 [mex-5p::MODC PEST::GFP::H2B::atg-4.2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM12 C. elegans sprSi11 II; unc-119(ed3) III. Show Description
sprSi11 [mex-5p::MODC PEST::GFP::H2B::cul-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM17 C. elegans sprSi13 II; unc-119(ed3) III. Show Description
sprSi13 [mex-5p::MODC PEST::GFP::H2B::ets-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM18 C. elegans sprSi14 II; unc-119(ed3) III. Show Description
sprSi14 [mex-5p::MODC PEST::GFP::H2B::hbl-1 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM19 C. elegans sprSi15 II; unc-119(ed3) III. Show Description
sprSi15 [mex-5p::MODC PEST::GFP::H2B::lin-26 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM22 C. elegans sprSi16 II; unc-119(ed3) III. Show Description
sprSi16 [mex-5p::MODC PEST::GFP::H2B::mbk-2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM24 C. elegans sprSi17 II; unc-119(ed3) III. Show Description
sprSi17 [mex-5p::MODC PEST::GFP::H2B::mex-3 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM27 C. elegans sprSi19 II; unc-119(ed3) III. Show Description
sprSi19 [mex-5p::MODC PEST::GFP::H2B::set-6 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM3 C. elegans sprSi3 II; unc-119(ed3) III. Show Description
sprSi3 [mex-5p::GFP::histone-H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Fluorescence in the distal germline and in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM30 C. elegans sprSi20 II; unc-119(ed3) III. Show Description
sprSi20 [mex-5p::MODC PEST::GFP::H2B::usp-14 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM5 C. elegans sprSi5 II; unc-119(ed3) III. Show Description
sprSi5 [mex-5p::MODC PEST::GFP::H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM66 C. elegans oma-1(ne5035[oma-1::GFP]) IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
WRM7 C. elegans sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM8 C. elegans sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM9 C. elegans sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM92 C. elegans oma-1(spr24[*ne5035]) IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. A triple arginine motif upstream of the oma-1 tandem zinc finger domain is mutated to three alanines. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes embryonic lethality: animals lay low numbers of nonviable embryos that are often polynucleated and have weak chitin shells. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
XE1375 C. elegans wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1474 C. elegans wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 C. elegans wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 C. elegans wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1593 C. elegans daf-16(mu86) I; wpSi14 II; daf-2(e1370) III. Show Description
wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228
ZT22 C. elegans fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT24 C. elegans vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT56 C. elegans fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZZY17 C. briggsae Cbr-unc-119(st20000) III; zzyIs17 V. Show Description
zzyIs17 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 6.9 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY25 C. briggsae Cbr-unc-119(st20000) III; zzyIs25 V. Show Description
zzyIs25 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 3.5 and 8.45 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY29 C. briggsae Cbr-unc-119(st20000) III; zzyIs29 IV. Show Description
zzyIs29 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.28 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY31 C. briggsae Cbr-unc-119(st20000) III; zzyIs31 IV. Show Description
zzyIs31 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 1.5 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY33 C. briggsae Cbr-unc-119(st20000) III; zzyIs34 X. Show Description
zzyIs34 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 2.37 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY37 C. briggsae Cbr-unc-119(st20000) III; zzyIs37 IV. Show Description
zzyIs37 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 15.35 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY43 C. briggsae Cbr-unc-119(st20000) III; zzyIs43 IV. Show Description
zzyIs43 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY49 C. briggsae Cbr-unc-119(st20000) III; zzyIs49 IV. Show Description
zzyIs49 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] IV. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 0 and 9.85 Mb on Chromosome IV. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY64 C. briggsae Cbr-unc-119(st20000) III; zzyIs64 X. Show Description
zzyIs64 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 9.74 and 21.54 Mb on Chromosome X. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.
ZZY66 C. briggsae Cbr-unc-119(st20000) III; zzyIs66 V. Show Description
zzyIs66 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] V. Transgene inserted into RW20000 Cbr-unc-119. Insertion site is between 7.75 and 17.07 Mb on Chromosome V. Reference: Bi Y, et al. PLoS Genet. 2015 Feb 18;11(2):e1004993.