Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
SHG578 C. elegans ustSi64 II. Show Description
ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
SHG659 C. elegans ustSi106 II. Show Description
ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
SHG670 C. elegans ustSi55 II. Show Description
ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.
SLR246 C. elegans unc-119(ed3) III; stxEx39. Show Description
stxEx39 [alx-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of alx-1 coding sequence in fosmid WRM064D_F05 by recombineering (TransgeneOme bacterial clone 095794875301489 F02). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
SLR247 C. elegans unc-119(ed3) III; stxEx48. Show Description
stxEx48 [C01A2.4::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of C01A2.4 coding sequence in fosmid WRM061C_F01 by recombineering (TransgeneOme bacterial clone 7225558184899882 D12). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
SLR248 C. elegans unc-119(ed3) III; stxEx35. Show Description
stxEx35 [istr-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of istr-1 coding sequence in fosmid WRM0636D_F01 by recombineering (TransgeneOme bacterial clone 5438954842362824 D10). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308
TAM109 C. elegans ramTi3 II. Show Description
ramTi3 [ubl-1::mCherry::pri-mir-58 + Cbr-unc-119(+)] II. mCherry-based sensor for pri-miR-58 processing. Weak ubiquitous mCherry fluorescence. MosSCI insertion. Previously described as ram3. Reference: Knittel TL, et al. Nat Commun. 2025 Jul 1;16(1):5595. doi: 10.1038/s41467-025-60721-5. PMID: 40595566.
TH175 C. elegans unc-119(ed3)III; ddIs97. Show Description
ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH189 C. elegans unc-119(ed3)III; ddIs106. Show Description
ddIs106 [hmg-3::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH199 C. elegans unc-119(ed3) III; ddIs115. Show Description
ddIs115 [R07E5.3::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH202 C. elegans unc-119(ed3) III; ddEx17. Show Description
ddEx17 [glh-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
TH205 C. elegans unc-119(ed3) III; ddEx120. Show Description
ddEx120 [cpar-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH206 C. elegans unc-119(ed3) III; ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Pick wild-type to maintain array. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
TH208 C. elegans unc-119(ed3) III; ddIs123. Show Description
ddIs123 [his-63::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH215 C. elegans unc-119(ed3)III; ddIs129. Show Description
ddIs129 [klp-4::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH234 C. elegans unc-119(ed3) III; ddIs145. Show Description
ddIs145 [klp-7::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH243 C. elegans unc-119(ed3) III; ddIs153. Show Description
ddIs153 [knl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH246 C. elegans unc-119(ed3) III; ddIs159. Show Description
ddIs159 [arx-2::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH346 C. elegans unc-119(ed3)III; ddIs193. Show Description
ddIs193 [rabs-5::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TJ3000 C. elegans zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3001 C. elegans zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TX585 C. elegans unc-119(ed3) III; teIs18 V. Show Description
teIs18 [sdz-23p::GFP::H2B::pie-1 3'UTR + Cbr-unc-119(+)]. Superficially wild-type. Integrated array carrying sdz-23 (F58G4.4) promoter fusion with bright GFP expression in E cell. Reference: Shetty P, et al. Dev Biol. 2005 Sep 15;285(2):584-92.
TYL8 C. elegans ieSi57 II; elt-2(syu3[elt-2::AID*::mNG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::mNG tag inserted at the 3' end of the endogenous elt-2 gene locus by CRISPR/Cas9 engineering. Guide sequence: 5'-UGCGGCUCGCGAUUUGGAAG-3'. ELT-2::AID*::GFP mainly expressed in the intestinal nucleus. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of ELT-2 protein in somatic tissues. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Li TY, et al. Nat Cell Biol. 2025 Jul;27(7):1083-1097. PMID: 40571723.
UX993 C. elegans jnSi12 II; ezIs2 III; ltIs37 IV. Show Description
jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
VH7211 C. elegans mrpl-40(hd7198[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/ oxTi731 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)] III. Show Description
Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VS10 C. elegans hjIs37. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.
VT3104 C. elegans maIs385 I; mir-34(gk437) X. Show Description
maIs385 [lim-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3105 C. elegans maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3106 C. elegans maIs387 I; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3107 C. elegans maIs388 II; mir-83(n4638) IV. Show Description
maIs388 [lim-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3108 C. elegans maIs389 II; mir-83(n4638) IV. Show Description
maIs389 [dpy-7p::mir-83 + Cbr-unc-119(+)] II. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3109 C. elegans maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3110 C. elegans maIs391 II; mir-83(n4638) IV. Show Description
maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3111 C. elegans maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3123 C. elegans maIs396 I; mir-34(gk437) X. Show Description
maIs396 [dpy-7p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3124 C. elegans maIs397 I; mir-34(gk437) X. Show Description
maIs397 [lag-2p::mir-34 + Cbr-unc-119(+)] I. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3294 C. elegans maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
WBM1438 C. elegans ieSi57 raga-1(wbm40[raga-1::AID*::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
WM242 C. elegans neSi12 II; unc-119(ed3) III. Show Description
neSi12 [cdk-1::GFP + Cbr-unc-119(+)] II. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
WM274 C. elegans prg-1(tm872) I; neSi14 II; unc-119(ed3) III. Show Description
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WM275 C. elegans prg-1(tm872) I; neSi15 II; unc-119(ed3) III. Show Description
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WRM1 C. elegans sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM10 C. elegans sprSi10 II; unc-119(ed3) III. Show Description
sprSi10 [mex-5p::MODC PEST::GFP::H2B::atg-4.2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM12 C. elegans sprSi11 II; unc-119(ed3) III. Show Description
sprSi11 [mex-5p::MODC PEST::GFP::H2B::cul-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM17 C. elegans sprSi13 II; unc-119(ed3) III. Show Description
sprSi13 [mex-5p::MODC PEST::GFP::H2B::ets-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM18 C. elegans sprSi14 II; unc-119(ed3) III. Show Description
sprSi14 [mex-5p::MODC PEST::GFP::H2B::hbl-1 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM19 C. elegans sprSi15 II; unc-119(ed3) III. Show Description
sprSi15 [mex-5p::MODC PEST::GFP::H2B::lin-26 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM22 C. elegans sprSi16 II; unc-119(ed3) III. Show Description
sprSi16 [mex-5p::MODC PEST::GFP::H2B::mbk-2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WRM24 C. elegans sprSi17 II; unc-119(ed3) III. Show Description
sprSi17 [mex-5p::MODC PEST::GFP::H2B::mex-3 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.