| EL597 |
C. elegans |
omIs1 II; met-2(n4256) unc-119(ed3) III. Show Description
omIs1 [met-2p::met-2::GFP + Cbr-unc-119(+)] II. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
|
|
| ERC102 |
C. elegans |
ieSi57 II; smc-3(syb5520[smc-3::GGGGS::AID*::emGFP]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.
|
|
| ERC103 |
C. elegans |
ieSi57 II; wapl-1(syb6035[wapl-1::GGGGS::AID*::emGFP]) IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. AID* and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: Cahoon CK, Libuda DE. Conditional immobilization for live imaging Caenorhabditis elegans using auxin-dependent protein depletion. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506.
|
|
| ERC82 |
C. elegans |
ieSi57 II; ers54[dpy-27::AID*::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC83 |
C. elegans |
ieSi57 ers55[top-2::AID*::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC84 |
C. elegans |
top-1(ers56[top-1::AID*::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERT529 |
C. elegans |
unc-119(ed3) III; jySi40. Show Description
jySi40 [vha-6p::NANOLUC::3xFLAG::unc-54 3' UTR + Cbr-unc-119(+)]. Can be used as a Nanoluciferase (NanoLuc) expressing control for luminescence in Promega NanoGlow Assays. Reference: Sfarcic I, et al. Genetics. 2019 Dec;213(4):1197-1207. doi: 10.1534/genetics.119.302655. PMID: 31585955.
|
|
| ESC332 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC352 |
C. elegans |
qzIs15[rpoa-2p::AID*::GFP::rpoa-2] I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC373 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC374 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC795 |
C. elegans |
ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC825 |
C.elegans |
wrdSi23 rpoa-2(cse772[AID*::GFP::rpoa-2]) I; ieSi11 II; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. ieSi11 [syp-3p::EmGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| EU3030 |
C elegans |
ijmSi3 I; unc-119(ed3) III; ltIs37 IV. Show Description
ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.
|
|
| EV484 |
C. elegans |
efIs155 II. Show Description
efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644
|
|
| FGP29 |
C. elegans |
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
| GC773 |
C. elegans |
unc-119(ed3) III; naIs3. Show Description
naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].
|
|
| GC817 |
C. elegans |
unc-119(ed3) III; naIs6. Show Description
naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].
|
|
| GC822 |
C. elegans |
unc-119(ed3) III; naEx75. Show Description
naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.
|
|
| GC827 |
C. elegans |
unc-119(ed3) III; naIs7. Show Description
naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.
|
|
| GLW27 |
C. elegans |
muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
|
|
| GLW29 |
C. elegans |
muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
|
|
| GR1719 |
C. elegans |
unc-119(ed3) III; mgSi3 IV. Show Description
mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
|
|
| GR1720 |
C. elegans |
unc-119(ed3) III; mgSi4 IV. Show Description
mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
|
|
| GS10037 |
C. elegans |
arSi159 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II; unc-119(ed3) III. Show Description
arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
|
|
| GT330 |
C. elegans |
aSi8 II; unc-119(ed3) III. Show Description
aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT332 |
C. elegans |
aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3UTR::Split 3 HygR::tjp2a_guide::Split 3 mScarlet-I::egl-13nls::tbb-2 3UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| GT337 |
C. elegans |
aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3 (delta)HygR + 3 (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
|
|
| GT347 |
C. elegans |
aSi23 II; unc-119(ed3) III. Show Description
aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT350 |
C. elegans |
aSi26 II; unc-119(ed3) III. Show Description
aSi26 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT372 |
C. elegans |
aSi31 II; unc-119(ed3) III Show Description
aSi31 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::ras-2-CAAX::SL2::mScarlet-I::ras-2-CAAX] II. mec-7 promoter driving membrane-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT375 |
C. elegans |
aSi27 II; unc-119(ed3) III. Show Description
aSi27 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7s::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7s in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GT377 |
C. elegans |
aSi36 II; unc-119(ed3) III. Show Description
aSi36 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p::GCaMP7f::SL2::mScarlet-I] II. mec-7 promoter driving expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.
|
|
| GW1262 |
C. elegans |
xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
|
|
| HA2619 |
C.elegans |
sod-1(tm776) II; rtSi1 IV. Show Description
rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
|
|
| HA2825 |
C.elegans |
smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
|
|
| HML1012 |
C. elegans |
cshIs140 II; ieSi58 IV. Show Description
cshIs140 [rps-28p::TIR1(F79G)::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Ubiquitously expressed single copy, modified TIR1 allele, TIR1(F79G) that is compatible with 5-PH-IAA and can be used to deplete auxin-induced degradation-tagged (AID-tagged) proteins. Efficiently depletes target proteins at 1 µM 5-Ph-IAA. Nuclear localized mCherry co-expression marker. Reference: Hills-Muckey et al. Genetics. 2022 Feb 4;220(2):iyab174. doi: 10.1093/genetics/iyab174. PMID: 34739048.
|
|
| HML1035 |
C. elegans |
cshIs128 II; ieSi58 IV. Show Description
cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.
|
|
| HS3545 |
C. elegans |
osIs158 II; ieSi58 IV. Show Description
osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| HS3750 |
C. elegans |
ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::TIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| JBL1 |
C. elegans |
tonSi1 II; unc-119(ed3) III. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. Maintain at 20-25C. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
|
|
| JBL2 |
C. elegans |
tonSi1 II; unc-119(ed3) III; ddIs6 V. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Maintain at 20-25C. Derived by crossing JBL1 and TH27. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
|
|
| JBL3 |
C. elegans |
tonSi1 II; unc-119(ed3) III; axIs1522. Show Description
tonSi1 [mex-5p::Dendra2::his-66::tbb-2 3'UTR + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 II. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Maintain at 20-25C. Derived by crossing JBL1 and JH2108. Reference: Bolkova J and Lanctot C (2015) Int J Dev Biol, in press.
|
|
| JH2932 |
C. elegans |
unc-24(e1172) mbk-2(pk1427) IV/nT1[let-?(m435)] (IV;V); ddEx16. Show Description
ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.
|
|
| JK5008 |
C. elegans |
qSi44 II; glp-1(q46) III. Show Description
qSi44 [glp-1::6xMyc6xHis + Cbr-unc-119(+)] II. Homozygous viable. Variable body length. May still carry unc-119(ed3) in the background. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
|
|
| JK5226 |
C. elegans |
glp-1(q46) III; qSi156 IV. Show Description
qSi156 [glp-1::Halotag + Cbr-unc-119(+)] IV. Mos insertion of Halo tagged GLP-1 in glp-1(null) background. qSi156 mostly rescues glp-1(q46) sterility; partially penetrant embryonic lethality, early larval lethality and dumpiness. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
|
|
| JK5500 |
C. elegans |
sygl-1(q828) I; qSi150 II. Show Description
qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
|
|
| JK5535 |
C. elegans |
glp-1(q46) III; qSi246 IV. Show Description
qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
|
|
| JK6690 |
C. elegans |
qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
|
|
| JK6691 |
C. elegans |
qSi423 II. Show Description
qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene. Qiu et al., in preparation.
|
|