| RP2700 |
C. elegans |
sdhd-1(tr409) II. Show Description
Homozygous viable. sdhd-1(tr409) is a T252A (H84Q) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2702 |
C. elegans |
mev-1(tr410) III. Show Description
Homozygous viable. mev-1(tr410) is a T407C (F136S) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2703 |
C. elegans |
sdhb-1(tr411) II. Show Description
Homozygous viable. sdhb-1(tr411) is a T779A (I260N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2706 |
C. elegans |
sdhb-1(tr414) II. Show Description
Homozygous viable. sdhb-1(tr414) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2748 |
C. elegans |
mev-1(tr423) III. Show Description
Homozygous viable. mev-1(tr423) is a G233A (C78Y) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2768 |
C. elegans |
sdhd-1(tr436) II. Show Description
Homozygous viable. sdhd-1(tr436) is a G283A (D95N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2776 |
C. elegans |
sdhb-1(tr438) II. Show Description
Homozygous viable. sdhb-1(tr438) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2813 |
C. elegans |
sdhb-1(tr454) II. Show Description
Homozygous viable. sdhb-1(tr454) is a C434T (P145L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2814 |
C. elegans |
sdhb-1(tr455) II. Show Description
Homozygous viable. sdhb-1(tr455) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RP2815 |
C. elegans |
sdhd-1(tr456) II. Show Description
Homozygous viable. sdhd-1(tr456) is a G289A (A97T) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
|
|
| RW1522 |
C. elegans |
pat-2(st538) unc-32(e189) III; stEx10. Show Description
Animals with the extrachromosomal array are Unc Rollers. Animals which have lost the array are Pat. Strain can be propagated by chunking. The exact construct used to create stEx10 is unknown; it is thought to carry a pat-2 rescuing construct (most likely a cosmid) with a Rol marker.
|
|
| SF1 |
C. elegans |
odc-1(pc13::Tc1) V. Show Description
Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.
|
|
| SG1 |
C. elegans |
nrx-1(ds1) V. Show Description
Homozygous viable and fertile. No gross behavioral abnormalities. Reduction of thrashing rate and expulsions during defecation cycle. Changed sensitivity to compounds. Increased sensitivity to aldicarb and levamisole in paralysis tests. Reduced sensitivity during egg laying to levamisole, 5-hydrosxytryptamine, and imipramine. Morphological defects in neurite fasciculation, neurite branching, and synapse formation. 1.5bk deletion at the 5' end of the mRNA.
|
|
| SJ4005 |
C. elegans |
zcIs4 V. Show Description
zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock.
|
|
| SM1508 |
C. elegans |
mxl-2(tm1516) III; bar-1(ga80) X. Show Description
Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.
|
|
| SP506 |
C. elegans |
clk-2(mn159) III. Show Description
Hypersensitive to UV and X irradiation, to to MMS. Reduced brood size at 20C; sterile at 25C. Increased spontaneous mutability. Previously called rad-5.
|
|
| SRS230 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx230. Show Description
sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SRS278 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx278. Show Description
sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SRS279 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx279. Show Description
sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SRS281 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx281. Show Description
sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SRS291 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx291. Show Description
sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SRS301 |
C. elegans |
pha-1(e2123) III; lite-1(ce314) X; sraEx301. Show Description
sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
|
|
| SSM264 |
C. elegans |
rad-51(iow53[GFP::rad-51]) IV/nT1[qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.
|
|
| SSM491 |
C. elegans |
ubc-9(iow97[3xFLAG::ubc-9]) IV/nT1[qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.
|
|
| SSR1164 |
C. elegans |
ssrIs919; ssrIs615. Show Description
ssrIs919 [daf-7p::flp-7::mCherry]. ssrIs615 [unc-122p::GFP]. Strain can be used for FLP-7 peptide secretion assays. Reference: Palamiuc L,. et al. Nat Commun. 2017 Jan 27:8:14237. doi: 10.1038/ncomms14237. PMID: 28128367.
|
|
| SV124 |
C. elegans |
lin-5(ev571) II. Show Description
Temperature sensitive - maintain at 15C. Recessive loss-of-function stronger with increases in temperature, nearly WT at 15C. At the non-permissive temperature DNA replication continues in the absence of mitosis. Mutants enter mitosis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. Molecular lesion is a 9 bp duplication followed by a T to C transversion. Mutagen was EMS but mutation likely caused by polymerase slippage.
|
|
| SV2061 |
C. elegans |
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
|
|
| SX9 |
C. elegans |
prg-1(n4503) I; prg-2(nDf57) IV. Show Description
Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.
|
|
| SZ155 |
C. elegans |
unc-73(e936) I; prp-8(az29) III. Show Description
prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.
|
|
| TG4100 |
C. elegans |
vtIs1 V; glit-1(gt1981) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.
|
|
| TG4103 |
C. elegans |
ttr-33(gt1983) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
|
|
| TG4298 |
C. elegans |
lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4300 |
C. elegans |
lem-3(gt3311[eGFP::Stag::lem-3[Y556A G558A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in conserved residues [Y556A G558A] of GIY-YIG nuclease domain. Homozygous viable, though [Y556A G558A] mutants exhibit increased embryonic lethality after irradiation and abolished localization of GFP::LEM-3 at the midbodies. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4319 |
C. elegans |
lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
|
|
| TJ356 |
C. elegans |
zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| TL24 |
C. elegans |
zdIs5 I; clr-1(cy14) II; slt-1(eh15) X. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.
|
|
| TLG697 |
C. elegans |
texIs127 X. Show Description
texIs127 [spp-9p::GFP] X. GFP expression in intestine and six aphid neurons, including AWB and AWC, serves as a reporter for DBL-1 signaling (fluorescence is high when DBL-1 signaling is low, and low when DBL-1 signaling is high). This reporter is also responsive to starvation, select bacterial pathogens, and loss of other innate immune signaling pathways, including tir-1 and pmk-1 (but not sek-1 or mek-1). texIs127 created by X-ray integration of extrachromosomal array wkEx52 into N2 animals using UV/TMP. Out-crossed five times to the N2. References: Lakdawala ML, et al. Mol Biol Cell. 2019 Dec 15;30(26):3151-3160. doi: 10.1091/mbc.E19-09-0500. PMID: 31693440. Roberts AF, et al. 2010 Jun 7:10:61. doi: 10.1186/1471-213X-10-61. PMID: 20529267.
|
|
| TV25876 |
C. elegans |
unc-10(wy1417[unc-10::GFP]) X. Show Description
GFP tag inserted into endogenous unc-10 locus. Created from germline flipped-out unc-10(wy1236). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV25898 |
C. elegans |
cla-1(wy1418[cla-1::GFP]) IV. Show Description
GFP tag inserted into endogenous cla-1 locus. Created from germline flipped-out cla-1(wy1218). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV25899 |
C. elegans |
rab-3(wy1419[GFP::rab-3]) II. Show Description
GFP tag inserted into endogenous rab-3 locus. Created from germline flipped-out rab-3(ox699). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.
|
|
| TV26024 |
C. elegans |
dma-1(wy1290[dma-1::FLPon::GFP]) I; wyIs581 IV; dyn-1(wy1150) wyIs910 X. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. dyn-1(wy1150) is a CRISPR-engineered point mutation creating a temperature-sensitive dynamin mutant. FLPon::GFP tag inserted into endogenous dma-1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
| UDN100028 |
C. elegans |
rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
|
|
| UDN100039 |
C. elegans |
sel-2(udn20) III. Show Description
Variant edit allele, G1514R. SpeI restriction site created by synonymous changes for ease of genotyping.
|
|
| UDN100043 |
C. elegans |
sel-2(udn24) III. Show Description
Control edit allele, G1514G. SpeI restriction site created by synonymous changes for ease of genotyping.
|
|
| UDN100047 |
C. elegans |
let-413(udn25) V. Show Description
let-413 [L248L]. Control edit. ApoI-HF restriction site created by synonymous changes for ease of genotyping. Wild-type looking.
|
|
| UDN100049 |
C. elegans |
let-413(udn27)/tmC3[egl-9(tmIs1230)] V. Show Description
let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.
|
|
| UDN100052 |
C. elegans |
let-413(udn30)V. Show Description
let-413 [L173L]. Control edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking.
|
|
| UDN100054 |
C. elegans |
let-413(udn32) V. Show Description
let-413 [L173M]. Variant edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking.
|
|
| UDN100080 |
C. elegans |
unc-116(udn42) III. Show Description
Control edit allele T90T. Wild-type looking. TspRI restriction site created by synonymous changes for ease of genotyping.
|
|
| UDN100083 |
C. elegans |
unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
|
|