Hypersensitive to UV and X irradiation, to to MMS. Reduced brood size at 20C; sterile at 25C. Increased spontaneous mutability. Previously called rad-5.

sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Temperature sensitive - maintain at 15C. Recessive loss-of-function stronger with increases in temperature, nearly WT at 15C. At the non-permissive temperature DNA replication continues in the absence of mitosis. Mutants enter mitosis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis. Molecular lesion is a 9 bp duplication followed by a T to C transversion. Mutagen was EMS but mutation likely caused by polymerase slippage.

he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.

Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.

prp-8(az29) is a G654E missense mutation. az29 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). It changes cryptic splicing of e936 to allow for an increase in full-length unc-73 expression. Reference: Mayerle M, et al. Proc Natl Acad Sci U S A. 2019 Feb 5;116(6):2193-2199. doi: 10.1073/pnas.1819020116. PMID: 30674666.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. gt1981 is a point mutation in a highly conserved residue. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/203067.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Strain does not roll obviously. Hypersensitive to oxidative stress: Increased dopaminergic neurodegeneration after 6-OHDA exposure and increased developmental delay after exposure to rotenone and paraquat. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.

Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.

Endogenous lem-3 locus carries GFP tag and two misense mutations in conserved residues [Y556A G558A] of GIY-YIG nuclease domain. Homozygous viable, though [Y556A G558A] mutants exhibit increased embryonic lethality after irradiation and abolished localization of GFP::LEM-3 at the midbodies. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.

Homozygous viable. Increased embryonic lethality after irradiation.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.

zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.

GFP tag inserted into endogenous unc-10 locus. Created from germline flipped-out unc-10(wy1236). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

GFP tag inserted into endogenous cla-1 locus. Created from germline flipped-out cla-1(wy1218). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

GFP tag inserted into endogenous rab-3 locus. Created from germline flipped-out rab-3(ox699). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. dyn-1(wy1150) is a CRISPR-engineered point mutation creating a temperature-sensitive dynamin mutant. FLPon::GFP tag inserted into endogenous dma-1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658

Variant edit allele, G1514R. SpeI restriction site created by synonymous changes for ease of genotyping.

Control edit allele, G1514G. SpeI restriction site created by synonymous changes for ease of genotyping.

let-413 [L248L]. Control edit. ApoI-HF restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.

let-413 [L173L]. Control edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

let-413 [L173M]. Variant edit. DdeI restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

Control edit allele T90T. Wild-type looking. TspRI restriction site created by synonymous changes for ease of genotyping.

nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping.

nekl-1 Control edit H292H. AvaII restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

nekl-1 Variant edit H292Q. AvaII restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size.

vps-34 [Y752Y] #1. Control edit for vps-34(udn80). StyI restriction site created by synonymous changes for ease for genotyping.

leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.

Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

jnSi12 [peel-1p::htas-1::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)] II. ezIs2 [fkh-6::GFP + unc-119(+)] III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP expression in spermatheca. mCherry expression in germline nuclei. UX993 sperm have increased mCherry intensity compared to that of its parent strains. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y65B4BL.5. External left primer: TATTCGGCTTTGAGGAGAGC. External right primer: AAAGGCCACTGGTGAGTTTG. Internal left primer: TGAACAAATGATTGAGCGACA. Internal right primer: ACCGATGAGCTCAAAACGAC. Internal WT amplicon: 1131 bp. Deletion size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

vkEx1093 [nhx-2p::mCherry::lgg-1]. Maintain by picking mCherry+ animals. Increased puncta under autophagy conditions. Reference: Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460.

vkEx1243 [nhx-2p::ubiquitin-V::mCherry + myo-2p::GFP]. Increased Ub-tagged mCherry accumulation upon blockage of the proteosome by RNAi. Faint mCherry expression in intestine. GFP+ pharynx. References: Miedel MT, et al. PLoS One. 2012;7(7):e40145. Gosai SJ, et al. PLoS One. 2010 Nov 12;5(11):e15460. Dantuma NP, et al. Nat Biotechnol. 2000 May;18(5):538-43.

Increased Oil-Red-O staining. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

Increased Nile Red and Oil-Red-O staining. Him. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

wwIs23 [nhr-178p::GFP + unc-119(+)]. Decreased GFP expression in the pharynx; no detectable expression in Int1 cells. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.

Nose touch defective. Slowed response to hyperosmotic solutions. Glutamate-gated current mediated by non-NMDA type receptors decreased in the AVA and AVD interneurons.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.

Mutator. Dominant RNA-i deficient. Temperature sensitive sterile. Maintain at 15-20 C. ne4253 is a C-to-T transition at position 3896 of the genomic DNA with respect to the +1 position of the ATG creating a T834M missense mutation. Reference: Gu, et al. 2009 Mol Cell 36:234-44.