More Fields
Strain Species Genotype
OH14070 C. elegans bnc-1(ot845[bnc-1::mNeonGreen::AID]) V. Show Description
bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14357 C. elegans mab-9(ot863[mab-9::TagRFP::AID]) II. Show Description
mab-9(ot863[mab-9::TagRFP::AID]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH15814 C. elegans him-5(e1490) V; dmd-4(ot935[dmd-4::GFP]) X. Show Description
GFP tag inserted into endogenous dmd-4 locus to create a C-terminal translational GFP fusion.
OH3191 C. elegans otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)]. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.
OH3487 C. elegans otIs114 I; cog-1(ot119) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot119. Rollers.
OH3491 C. elegans otIs114 I; cog-1(ot123) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. ot123 is a semi-dominant deletion allele of part of the cog-1 3' UTR, a lsy-6 miRNA target. Loss of miRNA regulation leads to ectopic expression of cog-1 in ASEL, which transforms ASEL to have ASER fate. otIs114, normally expressed in only ASEL and excretory gland cells, is lost in ASEL in ot123. Animals tend not to Roll.
OH3556 C. elegans che-1(ot124) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3568 C. elegans otIs114 I; cog-1(ot155) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot155. Rollers. Animals look Dpy.
OH3645 C. elegans otIs114 I; lsy-6(ot149) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3646 C. elegans otIs114 I; lsy-6(ot150) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lsy-6 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3679 C. elegans che-1(ot151) otIs114 I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3681 C. elegans otIs114 che-1(ot153) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3684 C. elegans otIs114 I; lsy-12(ot170) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Worms are slow growing.
OH3754 C. elegans otIs114 I; fozi-1(ot159) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3895 C. elegans otIs114 I; die-1(ot198) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3900 C. elegans otIs114 I; fozi-1(ot191) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH3902 C. elegans otIs114 I; cog-1(ot200) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot200. Rollers.
OH3903 C. elegans otIs114 I; cog-1(ot201) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot201. Rollers.
OH3959 C. elegans otIs114 I; die-1(ot231) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of die-1 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH3962 C. elegans otIs114 I; fozi-1(ot236) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH4013 C. elegans otIs114 che-1(ot232) I. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.
OH4027 C. elegans otIs114 I; fozi-1(ot234) III. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. fozi-1 mutant causes a mixed phenotype in the ASER neuron, characterized by ASER fate markers being unaffected and ASEL markers (including the lim-6 reporter) being partially de-repressed in ASER. otIs114 reporter shows expression in ASEL, the excretory gland cells, and is de-repressed in ASER.
OH4176 C. elegans otIs114 I; cog-1(ot242) II. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of cog-1 leads to the disruption of ASER fate markers and the ectopic expression of ASEL cell fate markers in ASER. otIs114, normally expressed in ASEL and excretory gland cells, is also ectopically expressed in ASER in ot242.
OH4974 C. elegans otIs114 I; lsy-12(ot89) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
OH707 C. elegans cog-1(ot38)/+ II; otIs114 I. Show Description
otIs114 [lim-6::GFP + rol-6(su1006)]. Rollers. Heterozygous strain. Heterozygotes should be fertile and segregate some sterile progeny. Maintain by picking plenty of animals with GFP in both ASEL and ASER; many of them will be sterile (homozygotes). otIs114 is normally expressed only in ASEL and excretory gland cell. Homozygous ot38; otIs114 is sterile and expresses GFP in both ASEL and ASER neurons. Heterozygotes display a semi-dominant, partially penetrant "ASEL + ASER" phenotype.
OH8001 C. elegans otIs114 I; lsy-12(ot177) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers. Whole genome sequenced strain.
PD6133 C. elegans tam-1(cc567) V. Show Description
Homozygotes have decreased expression of tandem array transgenes, descreased fertility and high incidences of males at 25C. Maintain strain at 16C.
PD6247 C. elegans tam-1(cc567) unc-46(e177) V. Show Description
Unc. Decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 16C.
PD6249 C. elegans ccIs4251 I; tam-1(cc567) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Homozygotes have decreased expression of tandem array transgenes, decreased fertility, and high incidences of males at 25C. Maintain at 15C.
PHX293 C. elegans nas-38(syb293) X. Show Description
Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
PHX700 C. elegans ilys-4(syb700) IV. Show Description
Complete knock out of gene. Increased L1 arrest sleep/quiescence. Reference: Konietzka et al. 2019. Current Biology (accepted).
PQ425 C. elegans apIs320 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PQ426 C. elegans apIs404 II; unc-119(ed3) III; unc-3(e151) let-7(mn112) X. Show Description
apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.
PS1493 C. elegans dpy-20(e1362) IV; syIs9. Show Description
syIs9 [pJMGoQL + (pMH86) dpy-20(+)]. Phenotype of dominant activated Go alpha is lethargic and egg-laying defective - phenotype increases in severity as animal matures and ages. Animals frequently wander to the side of the plate. Animals move with decreased amplitude of sinusoidal waves. Dpy and WT revertants are frequent. Linkage unknown. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4330 C. elegans spe-41(sy693) III; him-5(e1490) V. Show Description
Brood size 13.5 Brood size may increase after many passages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PY7505 C. elegans oyIs84. Show Description
oyIs84 [gpa-4p::TU#813 + gcy-27p::TU#814 + gcy-27p::GFP + unc-122p::DsRed]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gpa-4 promoter and gcy-27 promoter, respectively. ASI is ablated in this strain. Increased dauer formation. Expression of dsRed in coelomocytes. Reference: Beverly M, Anbil S, Sengupta P. J Neurosci. 2011 Aug 10;31(32):11718-27.
QC128 C. elegans paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC130 C. elegans paqr-3(ok2229) IV. Show Description
Superficially wild-type. Slight decrease in brood size and locomotion speed. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC155 C. elegans nhr-49(et8) I; mdt-15(et14) III. Show Description
This double mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QC156 C. elegans acs-13(et54) nhr-49(et8) I; mdt-15(et14) III. Show Description
This triple mutant strain contains an excess polyunsaturated fatty acids in its cell membranes accompanied by excess lipid peroxidation, cell permeability, increased autophagy and other defects. The acs-13(et54) mutation (G125R) can be detected using PCR with the following primers: WT FWD: 5´CTA CCA GGG TGT TCG CCA TG 3; acs-13 mutant FWD: 5´CTA CCA GGG TGT TCG CCA TA 3; acs-13 REV: 5´TCA AAC TTG GGC ATT GCT CC 3´. Annealing 65°C, expected product 395 bp. The nhr-49(et8) C9873765T [WS200] mutation can be detected by PCR using the following primers: nhr-49 Fwd: 5’-CAGATTATGATTCGTGATGCTAGA-3; nhr-49 WT Rev: 5’-GAGATGAAAGATGTTGCTGTAGAG-3; nhr-49 Mut Rev: 5’-GAGATGAAAGATGTTGCTGTAGAA-3’. Annealing 65°C, expected products ~300 bp. The mdt-15(et14) C5832666T [WS200] mutation can be detected by PCR using the following primers: mdt-15(et14) Mut Fwd: 5’-GTGCCTCCAGATCCACAGCT-3’; mdt-15(et14) WT Fwd: 5’-GTGCCTCCAGATCCACAGCC-3’; mdt-15 Rev: 5’-CACCCATTGGAGCACCACT-3’. Annealing 65°C, expected product ~400 bp. Reference: Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QP1208 C. elegans sws-1(ea12) V. Show Description
Increased lethality and male frequency. Synthetic lethal with helq-1(tm2134). Sensitive to camptothecin. Interacts with rip-1 and rfs-1. Reference: McClendon TB, et al. Genetics. 2016 May;203(1):133-45.
QQ250 C. elegans gin-1(cv10). Show Description
Gin is Glucose INtolerant. gin-1(cv10) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. Grown on HB101, HT115 or fresh OP50 (seeded less than five days)
QQ255 C. elegans gsy-1(gk397885) II. Show Description
Maternal-effect, diet/nutrition-dependent embryonic lethal. Strain segregates increased embryonic lethality when grown on glucose, UV-treated OP50, older OP50, and DA837. Lethality is suppressed on fresh OP50 (less than 5 days from seeding), HB101, and HT115.
QQ257 C. elegans gin-2(cv11). Show Description
Gin is Glucose INtolerant. gin-2(cv11) is a Diet/nutrition-dependent maternal effect embryonic lethal. Lethality is significantly increased with growth on OP50 seeded on glucose supplemented plates. 20C, Grown on HB101, HT115 or fresh OP50 (seeded less than five days).
RA454 C. elegans swsn-1(tm4567)/rol-9(sc148) V. Show Description
Heterozygotes are mostly wild-type but occasionally lack a gonad arm; segregate tm4567 homozygotes (larval/embryonic lethal) and rol-9 homozygotes (Rol). Pick non-Rol to maintain and screen for larval lethals (or by PCR) for tm4567 deletion. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RAF4 C. elegans cey-3(rrr11) cey-2(ok902) I. Show Description
Reduced brood size. cey-3(rrr11) was created using TALENs in the cey-2(ok902) mutant background to produce the double mutant. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.
RM2576 C. elegans cho-1(tm373) IV. Show Description
Canonical allele. Superficially wild-type. Frequency of spontaneous reversals approximately twice that of wild type. Initial L4 swimming rate approximately half that of wild type, and decreases steadily for 30 min, until the animals are immobile. Synthetic lethal with pmt-2 RNAi.
RM3571 C. elegans sup-1(e995 e2636) III. Show Description
Putative null allele; e995 e2636 homozygotes are superficially wild type in appearance, development, and behavior (except for a modest 20-25% decrease in swimming rate), and do not suppress unc-17(e245). e995 corresponds to G84E (gga>>gaa) and e2636 corresponds to W58stop (tgg>>tag). PCR methods for scoring e995 and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM523 C. elegans unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
RP1 C. elegans trIs10. Show Description
trIs10 [myo-3p::MB::YFP + myo-2p::YFP + ceh-23::HcRed + unc-25::DsRed + unc-129nsp::CFP].