xnIs312 [par-6p::par-6::mCherry + unc-119(+)]. Expresses par-6::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

wuIs177 [ftn-1p::GFP + lin-15(+)]. GFP expression in the intestine. ftn-1p::GFP transgene shows moderate basal expression under standard culture conditions in an otherwise wild-type background, but is strongly induced by reduced insulin/IGF-1 signalling, reduced HIF signalling, and increased free iron levels. References: Ackerman D & Gems D. PLoS Genet. 2012;8(3):e1002498. Valentini S, et al. Mech Ageing Dev. 2012 May;133(5):282-90.

arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. GFP is secreted from muscle cells. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.

Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

Superficially wild-type with increased sensitivity to paraquat in multiple assays. Can be maintained 15-25C. rt451 is CRISPR/Cas9 engineered G85R missense mutation in endogenous sod-1 locus mimicking human ALS SOD1 model. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.

goeIs257 [nas- 38p::d1mGFP::nas-38 3'UTR + unc-119(+)]. Destabilized GFP expressed from the nas-38 promoter; especially visible in hypodermis and excretory system. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs326 [hsp-16.2p::nlp-29::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of nlp-29::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goeIs388 [hsp-16.2p::cnc-1::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-1::SL2::mKate2 after heat shock causes increased quiescence in adults. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

hwSi3 [pie-1p::GFP::mex-3::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing full-length MEX-3 uniformly throughout oocytes and early embryos through the 4-cell stage. GFP::MEX-3 then mirrors endogenous MEX-3, disappearing from somatic cells by about the 12-cell stage. Also detected in P granules. GFP::MEX-3 can replace endogenous MEX-3. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi8 [pie-1p::GFP::mex-3(601-1248)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing a portion of MEX-3(601-1248) required for protein degradation. At about the 12-cell stage, soma-germline asymmetry is briefly visible before GFP::MEX-3(601-1248) becomes undetectable even in the germline blastomeres. Detected weakly on P granules only in the presence of endogenous MEX. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.

HG231 exhibits an approximately 20% increase in mean, median and maxium lifespans compared to N2. HG231 exhibits somewhat reduced fertility and somewhat longer development time than N2. It has a normal appearance, movements and mating behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

bpIs239 [W07G4.5p::W07G4.5::GFP + unc-76(+)]. W07G4.5::GFP is expressed in the intestine. A few GFP aggregates are formed in wild-type embryos at the four-fold stage; the number of aggregates is dramatically increased in epg-7 and atg-3 mutants. Reference: Lin L, et al. J Cell Biol. 2013 Apr 1;201(1):113-29.

bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. bp399 mutants accumulate SQST-1 aggregates strictly in the intestine in a distinct temporal pattern. SQST-1::GFP aggregates are absent in bp399 embryos, but start to form in L1 larvae and increase in number and size throughout larval development. Reference: Guo B, et al. EMBO Rep. 2014 Jun;15(6):705-13.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Displays tpa-1 phenotypes (e.g. resistance to PMA). Isolated in a genetic screen for mutants failing to show an induction of nlp-29p::GFP reporter gene expression upon infection with the fungus Drechmeria coniospora (the Nipi phenotype). References: Pujol N, et al. Curr Biol. 2008 Apr 8;18(7):481-9. Ziegler K, et al. Cell Host Microbe. 2009 Apr 23;5(4):341-52.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. dapk-1(gk219) decreases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. pinn-1(tm2235) increases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.

axIs1460 [pie-1p::GFP::pal-1(genomic)::pal-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. pal-1 coding region and 3’ sequences were amplified from genomic DNA and cloned into pDONR201 to create ORF+3’ Entry Clones.

zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.

Heterozygotes are WT and GFP+. q568(ts) homozygotes are sterile and can exhibit a white-patch phenotype. The severity of the white-patch increases with increasing temperature. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.

CRIPSR-engineered modification of gld-1 FBEa* in gld-1 3'UTR.  Homozygotes are fertile with a slight increase in distal GLD-1 protein levels. Reference: Qiu et al., In preparation.

q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR.  Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.

Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

Recessive, loss of function, early stop mutation within the coding sequence makes sa603 a likely null allele. Variable locomotion ranging from lethargic to hyperactive. Eat (pale, scrawny). Loopy movement - increased amplitude of locomotory wave-form (variable). Suppresses the enteric muscle contraction (EMC) defect, the lethargy and egg-laying defects of unc-43(n498).

Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.

seaIs201 [myo-3p::human tau (0N4R;V337M)::unc-54 3'UTR + vha-6p::mCherry::unc-54 3'UTR]. Reduced crawling speed, reduced brood size, shortened lifespan, slow development, early paralysis. Human tau transgene is expressed in body wall muscles, producing strong phenotypes suitable for screening and is sensitive to knockdown by feeding RNAi. Generated in N2 background.

Slowed development. Increased life span. Decreased embyronic viability. Decreased brood sizes.

ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.

Decreased brood size. Small body size. Slow growing. Resistant to 5HT serotonin.

tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

Small, slightly developmentally delayed. Increased Nile Red staining. Slightly more severe than mg360.

Small, slightly developmentally delayed. Increased Nile Red staining.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf13 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Wild-type segregating wild-type, Unc-101 (hIn1[unc-101] homozygotes) and arrested crescent-shaped larvae (eDf14 homozygotes, probably L1). Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.

cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]