CGC102 |
C. elegans |
mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by myo-2p::wrmScarlet. Generated in parental strain N2. Rollers. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC103 |
C. elegans |
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + lox2272]) V. Show Description
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet.
|
|
CGC104 |
C. elegans |
mir-61(umn16[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC102, leaving disrupted mir-61 locus.
|
|
CGC110 |
C. elegans |
mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC111 |
C. elegans |
mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
|
|
CGC112 |
C. elegans |
mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
|
|
CGC113 |
C. elegans |
mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC114 |
C. elegans |
mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet.
|
|
CGC115 |
C. elegans |
mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
|
|
CGC120 |
C. elegans |
mir-792(umn31[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-792 pre-miRNA deletion strain deletion allele in which mir-792 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC121 |
C. elegans |
mir-785(umn32[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-785 pre-miRNA deletion strain deletion allele in which mir-785 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC122 |
C. elegans |
mir-392(umn33[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-392 pre-miRNA deletion strain deletion allele in which mir-392 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC123 |
C. elegans |
mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) II. Show Description
mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC131 |
C. elegans |
mir-248(umn41[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC132 |
C. elegans |
mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) III. Show Description
mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC141 |
C. elegans |
mir-1821(umn48[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-1821 pre-miRNA deletion allele in which mir-1821 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC142 |
C. elegans |
mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC143 |
C. elegans |
mir-1021(umn50[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) IV. Show Description
mir-1021 pre-miRNA deletion allele in which mir-1021 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC144 |
C. elegans |
mir-1022(umn51[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1022 pre-miRNA deletion allele in which mir-1022 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC145 |
C. elegans |
mir-1824(umn52[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1824 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC146 |
C. elegans |
mir-800(umn53[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-800 pre-miRNA deletion allele in which mir-800 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC147 |
C. elegans |
mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC148 |
C. elegans |
mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC149 |
C. elegans |
mir-81(umn56[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC150 |
C. elegans |
mir-1829.3&F39B1.3(umn57[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])X. Show Description
mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC151 |
C. elegans |
mir-1829.2(umn58[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC154 |
C. elegans |
mir-4812(umn61[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
CGC169 |
C. elegans |
mir-788(umn76[mir-788p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
|
|
CGC171 |
C. elegans |
mir-799(umn78[mir-799p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
|
|
CGC179 |
C. elegans |
mir-82(umn86[mir-82p+SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
|
|
CP157 |
C. remanei |
nmDf1 III. Show Description
nmDf1 removes all four tandem paralogs of the mss family (Cre-mss-1, Cre-mss-2, Cre-mss-3, and Cre-mss-4). Male sperm is less competitive than wild-type male sperm, and females have lower brood size due to inbreeding depression. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
|
|
CP158 |
C. remanei |
Cre-mss-1(nm74[HA:Cre-mss-1]) III. Show Description
The hemaglutinin (HA) epitope tag was inserted using CRISPR/Cas9 through homologous recombination. The nine amino acid HA epitope was placed between C. remanei (EM464) MSS-1 residues 22 and 23, one residue downstream of the predicted mature N-terminus after signal peptide cleavage. NOTE: nm74 was originally described as nmIs9. Derived from parental strain SB146. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
|
|
DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
EG9876 |
C. elegans |
unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9881 |
C. elegans |
unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9882 |
C. elegans |
F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9885 |
C. elegans |
W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9887 |
C. elegans |
W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9888 |
C. elegans |
W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
EG9891 |
C. elegans |
unc-119(ox819) III; W03F9.11(oxTi1121) V. Show Description
oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
GS9801 |
C. elegans |
rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(flexon)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
|
|
KG4731 |
C. elegans |
unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
|
|
LP172 |
C. elegans |
hmr-1(cp21[hmr-1::GFP + LoxP]) I. Show Description
cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP252 |
C. elegans |
mrck-1(cp65[mrck-1::YPet + LoxP]) V. Show Description
cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP316 |
C. elegans |
hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP462 |
C. elegans |
mrck-1(cp189[mrck-1::GFP::3xFlag]) V. Show Description
cp189[mrck-1::GFP::3xFlag]. GFP inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
MSB1091 |
C. elegans |
mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
MSB1160 |
C. elegans |
mirSi16 II; unc-119(ed3) III. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
MSB340 |
C elegans |
mirEx96. Show Description
mirEx96 [flp-22p::CRE + unc-122p::mCherry]. Pick animals with red fluorescence in coelomocytes to maintain the array. SMD-specific CRE driver. Superficially wild-type. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
MSB486 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|