More Fields
Strain Species Genotype
KP3085 C. elegans nuIs122 IV. Show Description
nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.
KX54 C. elegans ifg-1(cxTi9279) II; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279) II; confirmed by triple primer PCR with 5’-ACCAAACTGGGCAAACAAAG-3’, 5’-GCTCAATTCGCGCCAAACTATG-3’, and 5’-CTTCCTGAAATTTGGTTTAACAGT-3’. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.
KX84 C. elegans ced-3(n2452) IV; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]
LE436 C. elegans swan-1(ok267) V. Show Description
F53C11.8. Homozygous. Outer Left Sequence: AGGCGGAGAAAGTGACTTGA. Outer Right Sequence: CCCCTCACGCAGTGTTTTAT. Inner Left Sequence: TGAAGCAAATTGCAATCCAG. Inner Right Sequence: AACGAAATTGTGATCGGAGG. Inner Primer WT PCR Product: 2317. Deletion size: 1190 bp.
LX1986 C. elegans vsIs177 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX671 C. elegans ocr-2(vs29) IV. Show Description
Lays 86% of its eggs at the 8-cell or earlier stage.
LX677 C. elegans rgs-7(vs98)/unc-1(n496) lon-2(e678) X. Show Description
Heterozygotes are Unc but not Lon. n496 is dominant. Segregates LonUnc. vs98 homozygotes are non-Unc, non-Lon and are Mel (they give only dead eggs). Strain will break down due to recombination so check for the presence of vs98 by PCR every few generations. Received new stock Feb 2005.
LX845 C. elegans ocr-2(ak47) IV; ocr-1(ok132) V. Show Description
Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA. ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele.
LX950 C. elegans ocr-4(vs137) IV. Show Description
Phenotypically WT. Deletion allele. A "T" is added also. The end points of the deletion are: TCGAACGTCAACAACATATTGCAAAT.....t.....TTGGAAAGGTAGGCTTACACTT TTTTTAA.
LX980 C. elegans ocr-4(vs137) IV; ocr-1(ok132) V. Show Description
vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA. Double mutants have reduced AWA gene expression. ok132 is a deletion and putative null allele. The boundaries of the deletion are: AGATTACTGATGCCATTGAACAAGTTCTCGTCA......TGATGTTTGAAAGGTGGAGT AGCAAAGAGA.
LX981 C. elegans ocr-4(vs137) ocr-2(ak47) IV. Show Description
ak47 is chemosensory, mechanosensory and osmosensory defective, and is a null allele. vs137 is a deletion allele. A "T" has been added. The endpoints of the deletion are: TCGAACGTCAACAACATATTGCAAAT.......T.......TTGGAAAGGTAGGCTTAC ACTTTTTTTAA.
LX982 C. elegans ocr-4(vs137) ocr-2(ak47) IV; ocr-1(ok132) V. Show Description
Chemosensory, mechanosensory, and osmosensory defects.
LX990 C. elegans lin-15B&lin-15A(n765) X; vsEx494. Show Description
vsEx494 [ocr-2p::GFP::ocr-2 3'utr + lin-15(+)]. Labels the cells that express ocr-2. Pick non-Muv and GFP+ to maintain.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MQD1779 C. elegans daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MSB510 C elegans mirIs37. Show Description
mirIs37 [acr-5p::CRE + myo-2p::mCherry]. Superficially wild-type. CRE expression is driven predominantly in B-type motor neurons; CRE activity has also been observed in a few other cells. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MT16061 C. elegans mir-238(n4112) III; nDf62 X. Show Description
4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.
MT18016 C. elegans nDf63 III; mir-63(n4568) X. Show Description
Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
MT4732 C. elegans clr-1(n1992) II; egl-15(n1477) X. Show Description
Non-Scr, non-Clr. Egl.
MT6241 C. elegans acr-2(n2420) X. Show Description
Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.
MT9772 C. elegans mod-5(n3314) I. Show Description
Serotonin hypersensitive. Isolated as a 1688 bp deletion. Backcrossed 6 times using PCR as the assay to follow mutant chromosome. 5-HT hypersensitivity phenotype does segregate after 6 backcrosses. Hyperslowing in locomotion assay as well.
NC1013 C. elegans unc-119(ed3) III; wdEx455. Show Description
wdEx455 [acr-14::GFP + unc-119(+)]. Pick non-Unc to maintain.
NC168 C. elegans unc-4(e26) II; dpy-20 IV; wdEx60. Show Description
wdEx60 contains [acr-5::GFP + dpy-20(+)]. Maintain by picking non-Dpy.
NC216 C. elegans lin-15B&lin-15A(n765); wdEx75. Show Description
wdEx75 [acr-5::GFP + lin-15(+)]. Expressed in B-type motor neurons.
NC292 C. elegans acr-5(ok182) III. Show Description
No obvious phenotype. 1.5 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Left breakpoint sequence: TGGGTGATGCTATATGCACA. Right breakpoint sequence: TAGACTTCCGAGCAATAATTC.
NC293 C. elegans acr-5(ok180) III. Show Description
No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.
NC467 C. elegans acr-5(ok205) III. Show Description
No obvious phenotype. 2.4 kb deletion of acr-5 produced by Moulder/Barstead at OMRF.
NC574 C. elegans wdIs22. Show Description
wdIs22 [acr-5p::YFP + rol-6(su1006)]. Integrated array derived from wdEx223. Maintain by picking Rollers.
NC782 C. elegans unc-119(ed3) III; wdEx290. Show Description
wdEx290 [acr-15::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC972 C. elegans wdEx419. Show Description
wdEx419 [acr-16::GP + rol-6(su1006)]. Rollers. Maintain by picking rollers. GFP expression detectable in body wall muscle and DB motor neurons.
NH2038 C. elegans clr-1(e2530) II; egl-15(n1477) X. Show Description
Non-Scr, non-Clr. Egl.
NK2322 C. elegans cle-1(qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2326 C. elegans emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2335 C. elegans lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2353 C. elegans agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2404 C. elegans epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2413 C. elegans sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2422 C. elegans him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2425 C. elegans lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2442 C. elegans mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
NK2443 C. elegans nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2444 C. elegans pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2445 C. elegans pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2456 C. elegans ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2457 C. elegans ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2476 C. elegans ina-1(qy46[ina-1::mKate+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.
NK2477 C. elegans ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.