RG3084 |
C. elegans |
C25D7.1(ve584[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3073 |
C. elegans |
C25D7.16(ve573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 323 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGTTCAACAATCGATTGAAATTCGTGTTA ; Right flanking sequence: ACCGGCGTTCAGACAGTCTCCACAAAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RW10900 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10823. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10823 [C25D7.10::H1-wCherry + unc-119(+)].
|
|
TY1077 |
C. elegans |
C25D7.12(y128) unc-76(e911)/sdc-3(y52) unc-76(e911) V; xol-1(y9) X. Show Description
Heterozygotes are Unc and segregate Uncs, Dpy Uncs [C25D7.12(y128) unc-76(e911) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
TY1388 |
C. elegans |
C25D7.12(y128)/sdc-3(y52) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Dpys [C25D7.12(y128) homozygotes], and Tra Uncs [sdc-3(y52) unc-76(e911) homozygotes]. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|