Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4310 C. elegans C18D11.10(gk5393[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1832 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATAACCCGAAGAGGAGATGCGAGAACGATG; Right flanking sequence: CTAGGTGTCAATGTGAAATGTTTTTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.