sEx10484 [rCesC18D11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

C18D11.2. Homozygous. Outer Left Sequence: TACTACGGAGAGACCCACGC. Outer Right Sequence: TTCGAAATGTCGGTGTTTGA. Inner Left Sequence: GCATTTTTCTTCCCCCAGTT. Inner Right Sequence: CAGGGTCTCACCACAAGTCA. Inner Primer PCR Length: 2684 bp. Deletion Size: 876 bp. Deletion left flank: GGCTTCATCCATCGTCATGTTGTCCAGCTT. Deletion right flank: TTAGTTTTACAATCGAGCCGCGACGCGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18D11. Superficially wild type. External left primer: GTCGTCAGCTGATTCGTCAA. External right primer: GCGTGTTAGAAACGTGCAAA. Internal left primer: ACCGTATCCCCGGTTTTTAG. Internal right primer: TGCGATCTGCTATTGCTACG. Internal WT amplicon: 2922 bp. Deletion size: 773 bp. Deletion left flank: TACGGGTTGATCTACAAAAAACGCGGGAAT. Deletion right flank: GGTTTTTCAACTTTCTTCAAAAAAAATTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1832 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATAACCCGAAGAGGAGATGCGAGAACGATG; Right flanking sequence: CTAGGTGTCAATGTGAAATGTTTTTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.