More Fields
Strain Species Genotype
CB4852 C. elegans Show Description
Wild type. Low Tc1 copy number; pattern X. [Obtained from Rothamsted by S. Brenner as 'Panagrellus redivivus'. Cross fertile with C. elegans N2.] Caenorhabditis elegans wild isolate. CB subclone of N3 (Tc1 pattern X).
CB4853 C. elegans C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1; pattern III. Caenorhabditis elegans wild isolate. CB subclone of GA-12 (Tc1 pattern III). To obtain ECA245, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4854 C. elegans Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1, pattern V. Caenorhabditis elegans wild isolate. CB subclone of GA-9 (Tc1 pattern V).
CB4855 C. elegans C. elegans wild isolate. Show Description
NOTE: Whole-genome analysis indicates that this stock is genotypically CB4858. Users interested in this strain are encouraged to obtain a verified CB4855-derivied strain. To obtain ECA247, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org. Isolated from compost in Palo Alto, CA in 1982(?). Wild type (plg-1(e2001)). Low copy Tc1, pattern VI. Caenorhabditis elegans wild isolate CB subclone of Sta-5 (Tc1 pattern VI). Original stock isolated by T. Doniach.
CB4856 C. elegans Show Description
Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.]
CB4857 C. elegans C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4858 C. elegans C. elegans wild isolate. Show Description
Isolated from Caltech flowerbed in the summer of 1971 (1973??) in Pasadena, CA. Wild type. Low copy Tc1; pattern XI. Caenorhabditis elegans wild isolate. EM subclone of PA1 (Tc1 pattern XI). To obtain ECA251, a sequenced isolate of this wild strain, please visit the C. elegans Natural Diversity Resource at www.elegansvariation.org.
CB4932 C. elegans Show Description
Wild isolate with unique Tc1 pattern. Bor phenotype. Isolated by P.S. Grewal before 1991, from mushroom farm near Taunton, England. Sent to Ann Burnell in 1991. Sent from Burnell to J. Hodgkin in Jan. 1992. Sent to CGC in Jan. 1997. Caenorhabditis elegans wild isolate.
CC1 C. elegans Show Description
Continuously cultured in liquid CeMM for 4 years.
CC3 C. elegans Show Description
This strain was grown on CeMM (C. elegans Maintenance Medium) for 3 years (called CC1). It was then flown on STS-107, shuttle Columbia (and now called CC3).
CGC1 C. elegans C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
CGC32 C. elegans sC1(s2023) [dpy-1(s2170) umnIs21] III]. Show Description
umnIs21 [myo-2p::GFP + NeoR, III: 518034 (intergenic)]. Dpy GFP+. Derived by insertion of myo-2p::GFP transgene into sC1 balancer in parental strain BC4279 using CRISPR/Cas9.
CGC43 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
CGC48 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Hets are WT mKate2+ and segregate WT mKate2+, Unc-4 (no red fluorescence) and paralysed DpyUnc mKate2+ (mnC1). Maintain by picking WT mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain SP127 using CRISPR/Cas9.
CGC51 C. elegans sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CH118 C. elegans nid-1(cg118) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.
CH1180 C. elegans unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
CH119 C. elegans nid-1(cg119) V. Show Description
Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.
CH120 C. elegans cle-1(cg120) I. Show Description
Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.
CH1315 C. elegans zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
CV98 C. elegans him-18(tm2181)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735.
CW16 C. elegans unc-79(ec1) III. Show Description
CY401 C. elegans sqt-1(sc13) age-1(mg109)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqt. age-1(mg109) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive). age-1(mg109) homozygous animals that are maternally rescued for dauer formation are long-lived.
DA1370 C. elegans avr-15(vu227) glc-1(pk54) V. Show Description
Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
DA1384 C. elegans avr-14(ad1302) I; glc-1(pk54) V. Show Description
glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.
DA686 C. elegans nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]
DC1 C. elegans bah-1(br1) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
DH424 C. elegans Show Description
Interfertile with N2. Survives freezing lin liquid nitrogen. Temperature sensitive. Brood size like N2. Generation time like N2. Spontaneous males. Reference WBG 10(2) 140-141. Isolated in El Prieto Canyon, CA. Caenorhabditis elegans wild isolate (Tc1 pattern HCC).
DM3414 C. elegans unc-4(e120) let-268(ra414)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and lethals.
DM7392 C. elegans pha-1(e2123) III; raEx392. Show Description
raEx392 [T05G5.1p::T22C1.6(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DP13 C. elegans Show Description
For PCR STS mapping. Differs from RW7000 in two Tc1 sites. Caenorhabditis elegans wild isolate. DP subclone of RW7000.
DP246 C. elegans unc-45(st601)/sC1 [dpy-1(s2170)] III. Show Description
Made from LV15. st601 is a non-conditional two-fold arrest lethal.
DQM1041 C. elegans bmdSi282. Show Description
bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1051 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1059 C. elegans bmdSi245 I; hda-1(bmd134[hda-1::GFP::loxP]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1066 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1068 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1070 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1072 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1152 C. elegans bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
DQM1285 C. elegans bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. Show Description
bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM935 C. elegans bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::fos-1]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM973 C. elegans bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM979 C. elegans bmdSi245 swsn-8(bmd222[(swsn-8p::swsn-8::GFP]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM984 C. elegans bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DR1218 C. elegans mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-265(mn188) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Unc-4 (lethal mid-larval). Maintain by picking WT.
DR1344 C. elegans Show Description
Reference WBG 10(2) 140-141. Previously called Bergerac LY and Bergerac BO. Caenorhabditis elegans wild isolate. DR subclone of Bergerac BO (Tc1 pattern HCA).
DR1345 C. elegans Show Description
Reference WBG 10(2) 104-141 and 11(5) 60. Caenorhabditis elegans wild isolate. DR subclone of Cl2a (Tc1 pattern II).
DR1346 C. elegans Show Description
Reference WBG 10(2) 140-141. Caenorhabditis elegans wild isolate. DR subclone of GA-1 (Tc1 pattern I).