More Fields
Strain Species Genotype
VC990 C. elegans cnb-1(ok276) V. Show Description
F55C10.1. Slow-growing with small broods. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH725 C. elegans pha-1(e2123) III; hdEx231. Show Description
hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.
WE5172 C. elegans dpy-5(e907) I; ajIs1 X. Show Description
ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.
WU209 C. elegans cdf-1(n2527) X. Show Description
Severe loss of function/null. Weak vulvaless phenotype (subtle defect in vulval cell lineages). Nonsense change of codon 186 of the predicted ORF C15B12.7. See also WBPaper00005255.
XE2031 C. elegans wpIs107 I. Show Description
wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. F49C12.10 also known as nemt-1. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
XT3 C. elegans cln-3.3(gk118) V. Show Description
Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.
ZB1030 C. elegans crt-1(bz31) V. Show Description
Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.
ZD1258 C. elegans eif-3.L(qd310) II. Show Description
C17G10.9 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326.
ZM3087 C. elegans unc-9(fc16) unc-7(e5) X. Show Description
Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.
ZM8969 C.elegans flp-14(gk1055) III. Show Description
Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZT73 C. elegans coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.