Homozygous viable. Deletion of 2028 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TCGCAATAACCAATTTTACAAAACTAGAGG. Right flanking sequence: TGGGTTGATTTAAATTAAATATCATGTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 897 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: AAAGATTTGCGGTGAAAATCGAAATAAAAT. Right flanking sequence: AACGTAGTCCGATTCGCTAGACGCCTAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ZC168.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP (strong signal represents mIs11 homozygotes, weaker signal represents gk35/mIs11) and non-GFP gk35 homozygotes that generally develop into sterile adults. Sterility seems to be male-rescuable. GFP may be seen in early embryos (4-cell onward) and gut. Pick fertile WT to maintain, but check for proper segregation of gk35 steriles. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC168.4. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk35 hermaphrodites (sterile). Sterility seems to be male-rescuable. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A11.3a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15B12.5a. Apparently lethal deletion balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males (szT1 hemizygotes) and gk269 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok841 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18A3.8. Homozygous lethal or viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok780 homozygotes (early larvae are misshapen with lumpy tails and most often arrest; escapers are Unc and can reach adulthood, and may be sterile or fertile). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B1.1. Him, otherwise superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16A3.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok815 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.9, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk284 homozygotes (early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44C11.1. Superficially wild type. External left primer: GTCCAAGTCGTCAAGGCAAT. External right primer: GCAGGAAGATCGGTAAGCAC. Internal left primer: CCAAAGAAATCCCGTTTTGA. Internal right primer: ACGCTATAGCCTTCCCCAAT. Internal WT amplicon: 3114 bp. Deletion size: 1173 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53C11.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok964 homozygotes (WT appearance, lays eggs that do not hatch). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16A3.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok961 homozygotes (sterile adult with vulval defects, sometimes explodes at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06C12.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.7b. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E4.4, C17E4.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1121 homozygotes (probable early larval arrest, but stage not determined rigorously). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03C11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A4.1, C14A4.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT relatively dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk347 homozygotes (L4 to young adult arrest, often bursts at gonadal placque or vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

VF11C1L.1. Homozygous sterile deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, ok1150 hemizygotes (WT males) and ok1150 homozygotes (usually sterile, sometimes Dpyish, may produce a few progeny). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.7b. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27C12.6. Deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT and segregate WT, arrested szT1 aneuploids, Lon-2 males, WT males (ok1198 hemizygotes) and ok1198 homozygous hermaphrodites (arrest stage/phenotype undetermined - may be slow-growing viable). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C11E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk348 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A4.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk398 homozygotes (sterile adult with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10G11.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1435 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56C10.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1355 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.8. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk427 homozygotes (slow-growing, often sterile, mildly Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C10.1. Slow-growing with small broods. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.

ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.

Severe loss of function/null. Weak vulvaless phenotype (subtle defect in vulval cell lineages). Nonsense change of codon 186 of the predicted ORF C15B12.7. See also WBPaper00005255.

wpIs107 [F49C12.10p::GFP] I. GFP expression in CAN neurons can be used to isolate CAN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.

C17G10.9 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326.

Kinkers. References: Yeh E, et al. J Neurosci. 2009 Apr 22;29(16):5207-17. Kawano T, et al. Neuron. 2011 Nov 17;72(4):572-86.

Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.