cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.

Reduced fertility. Reduced long-term survival. Mutator phenotype. DNA damage-induced apoptosis in the germ line. No effect on lifespan or meiotic chromosome disjunction observed.

Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.

wgIs717 [K04C1.3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.

Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.

Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.

Heterozygotes are WT and segregate WT, paralyzed Dpys and dead eggs. cc507 is a recessive embryonic lethal.

Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.

Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.

Heterozygotes are WT and segregate WT, paralyzed Dpys and embyronic lethals.

Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.

Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.

Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.

Heterozygotes are Unc (Paralyzed adult) and segregate more Unc, DpyUnc and dead eggs. Pick Unc to maintain. Balanced well.

Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.

Unc. Previously described as hC1 (hC1 also known as hIn1). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are approx. wild-type in size and Muv. Pick Muv non-Unc (heterozygotes) to maintain. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

syIs605 [15xUAS::iC1-C2-TS::EYFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. Chloride-conducting channelrhodopsin cGAL effector.

C42C1.13; might also remove part of C42C1.11. Homozygous. Outer Left Sequence: aaacacgaaacactcgcctt. Outer Right Sequence: ccgatcctttttcgtatgga. Inner Left Sequence: ccttaaaagagtctcggccc. Inner Right Sequence: atgaaaaagcgtcatctggg. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.2b Homozygous. Outer Left Sequence: aaaaatgggcgtgttcagtc. Outer Right Sequence: aaccgtcgaccaattctgac. Inner Left Sequence: ccgaaggatgcagaaacatt. Inner Right Sequence: gtgggcggagtcaactaaag. Inner Primer PCR Length: 3015. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.5 Homozygous. Outer Left Sequence: acacacccagaagaccatcc. Outer Right Sequence: tgagcattccttttgggaac. Inner Left Sequence: tgcttttcccgttcaaactt. Inner Right Sequence: cagaatgcctgtttctccgt. Inner Primer PCR Length: 2208. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06C1.1. Homozygous. Outer Left Sequence: CTATTTAAAGGCGCACAGCC. Outer Right Sequence: CCAGATGAGCCTCCAACACT. Inner Left Sequence: AATGGCCCAAAATCACAAAA. Inner Right Sequence: GCATCGTGTTCGAATGACAC. Inner Primer PCR Length: 3336 bp. Deletion Size: 2289 bp. Deletion left flank: GAATTTTTGCCGAAAACTGAGAAAATCTTC. Deletion right flank: AAAAATTCTGAAAATGCAAAATTTCAGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

LLC1.1. Homozygous. Outer Left Sequence: TTGAGCACAACCTGAAGCAG. Outer Right Sequence: AAAACTCCTATTTGCCCGCT. Inner Left Sequence: TCACAGTTTTCGGGTTTTCC. Inner Right Sequence: AGATGTTTCCGGTGGAGTTG. Inner Primer PCR Length: 3226 bp. Deletion Size: 1474 bp. Deletion left flank: AAAGAACTGAAGTTATGTTTATTGGTTAAT. Deletion right flank: TCTCATTTTGAACTAGAAACTATTGCTAAC. Insertion Sequence: CTTCAGAAAAATATTACAAATTGTATCTTTTTACACAAGATTTTAAATTTTTAAAAATA AAATCTGAAACAATTTTGTCTAATAAAAACAAAGGCCCTCATGAATTGTTTATGAAAAT TATCACCCAAATAAGTTGATTAACTTGGGCGGGGCTTATTTTACAGGTTTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F10C1.2. Homozygous. Outer Left Sequence: AATTAGCTTCCCCGCAATTT. Outer Right Sequence: GTTGTTGATGCCTCCTTGGT. Inner Left Sequence: CTTTAGTTGACTCCGCCCAC. Inner Right Sequence: GCAAATGCGAGAAACCCTTA. Inner Primer PCR Length: 2999 bp. Deletion Size: 2379 bp. Deletion left flank: CAATTTCTAAGTAAGTAGTGTCTTGATCTC. Deletion right flank: AGCTTTTTGGTTTTGAAATGTTGAAAATTT. Insertion Sequence: ATTTCTAAGTAAGTAGTGTCTTGATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.10 Homozygous. Outer Left Sequence: acgacttccaattgcattcc. Outer Right Sequence: acttccacatccaagaaccg. Inner Left Sequence: ctcacaaattcgaacggaaa. Inner Right Sequence: gcatcgtcaaaccactgaaa. Inner Primer PCR Length: 3301. Deletion size: about 2900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22C1.6 Homozygous. Outer Left Sequence: aagccaagagcaaattggaa. Outer Right Sequence: attttcttgtccgatgtggc. Inner Left Sequence: cagaggacttcaaaaggcga. Inner Right Sequence: cggcatattcttgatttgtca. Inner Primer PCR Length: 1229. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C1.9. Homozygous. Outer Left Sequence: catcaacagctgcgaaacat. Outer Right Sequence: atcatgacatcgtggctgaa. Inner Left Sequence: agtccgaatcgatccctctt. Inner Right Sequence: caccgcctctctttctcaac. Inner primer WT PCR product: 2883. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05C1.4. Homozygous. Outer Left Sequence: TGATTCTGTCCGGGATCTTC. Outer Right Sequence: ACATAATCCTTGCCGCAAAC. Inner Left Sequence: GAGCTCTTGCATTAGGTGGC. Inner Right Sequence: TTTCCAGCTCCCAATTCATC. Inner primer WT PCR product: 2739. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygotes have small broods that never mature. Deletion of 401 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 have small broods that never mature (ve588 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatctatagtttttctcacaggaaATGGA; Right flanking sequence: ttaggctcttttccataaattttcccttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous Sterile. Deletion of 465 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve621 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: agggtttctaaatatcttttaaaacctttg ; Right flanking sequence: AACGTCGTGACACGATAAAGAACGAGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygotes are unhealthy, lay small broods. Deletion of 696 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 unhealthy animals (ve654 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcactacattgcctcCTAACATGTCCTTCC ; Right flanking sequence: gggggtttcctctttctttctttttaaaga. sgRNA #1: ATACATATTATTGGATTGGA; sgRNA #2: attgaaatggagaaggacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve655 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CTCTTCTAAGCTGATCAAGACGGGCCTGAA ; Right flanking sequence: AGGAAATCCATctgaaaagtggaatatttc. sgRNA #1: TGATGTTGACGATGATCTTC; sgRNA #2: tttcagATGGATTTCCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous larval arrest. Deletion of 1461 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve667 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aacttgtgtggatttacgggcaaacagccg ; Right flanking sequence: ACAATATTACTGAAAGCTAGatttctctga. sgRNA #1: ataaaatttgttttgcgcaa; sgRNA #2: AGCGCCAGTCGTTGTATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.