| ML732 |
C. elegans |
vha-5(mc38)/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
|
|
| ML846 |
C. elegans |
vha-5(mc38) IV; mcEx337. Show Description
mcEx337 [vha-5(+)::GFP + rol-6(su1006)]. Animals with the array are Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
|
|
| ML851 |
C. elegans |
vha-5(mc38) IV; mcEx342. Show Description
mcEx342[vha-5(E830Q)::GFP + rol-6(su1006)]. Animals with the array are slightly Dpy and are occasionally Rollers and GFP+ in the excretory canal. Animals which have lost the array are dead L1 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
|
|
| MLC610 |
C. elegans |
cah-3(luc28[3' UTRmutant, delta mir-791 binding sites]) Show Description
luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
|
|
| MLC698 |
C. elegans |
mir-255(luc38) V. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).
|
|
| MP109 |
C. elegans |
unc-8(lb109) IV. Show Description
Coils. Backs fairly well. The coiling phenotype is semi-dominant.
|
|
| MP125 |
C. elegans |
unc-8(n491) sup-41(lb125) IV; deg-1(u38) X. Show Description
Animals move sluggishly but are able to back, despite n491. lb125 also partially suppresses the tail touch insensitive phenotype of u38 in cold-sensitive fashion: at 25C -> 0%; at 20C -> 5%; at 15C -> 30%.
|
|
| MP130 |
C. elegans |
sup-40(lb130)/+ I; unc-8(e15) IV; egl-1(n487) V. Show Description
lb130/+ dominantly suppresses the e15 backing defect and causes recessive sterility. Three phenotypes are present in this strain: backing steriles (lb130 homozygotes), backing fertiles which are bloated (heterozygotes), and non-backing coiled Unc animals which are fertile and bloated (sup-40(+)). Maintain strain by picking fertile animals which can back. egl-1(n487) is included in the strain to facilitate identification of lb130 homozygotes, which grow slowly; their sterility contrasts with the bloating of lb130/+ heterozygotes.
|
|
| MP141 |
C. elegans |
sup-43(lb141) II. Show Description
Allele-specific suppressor of unc-8(e49). lb141 single mutant animals are coiler Uncs. Both suppression of e49 and coiling are recessive.
|
|
| MP145 |
C. elegans |
unc-8(e15lb145) IV. Show Description
Intragenic unc-8 revertant. Appears wild type. Probable null allele.
|
|
| MP150 |
C. elegans |
unc-8(e15) IV; lbEx9. Show Description
lbEx9 [R31A1(cosmid) + rol-6(su1006)]. Pick non-Unc Rol to maintain. This strain was obtained by co-injection of plasmid pRF4 and cosmid R13A1 into gonads of unc-8(e15) animals. Reference: Shreffler W, Wolinsky E. Behav Genet. 1997 May;27(3):211-21.
|
|
| MP151 |
C. elegans |
unc-8(e15) IV; sup-42(lb88) X. Show Description
WT. lb88 is a recessive X-linked suppressor of unc-8 dominant mutations.
|
|
| MP152 |
C. elegans |
dpy-13(e184) unc-8(e15lb55) IV. Show Description
Dpy.
|
|
| MP153 |
C. elegans |
unc-8(n491) IV; sup-42(lb88) X. Show Description
WT.
|
|
| MP154 |
C. elegans |
unc-8(e15) IV; egl-15(n484) sup-42(lb88) X. Show Description
Egl. Unc slightly suppressed; the animals will usually back some. [unc-8(e15); egl-15(n484) animals are extremely Unc and will not back.]
|
|
| MP155 |
C. elegans |
sup-43(lb141) II; unc-8(e49) IV. Show Description
Animals have nearly WT movement. lb141 is an allele-specific recessive suppressor of e49.
|
|
| MP82 |
C. elegans |
unc-8(n491lb82) IV. Show Description
WT. n491lb82/++ trans heterozygotes coil and back very poorly.
|
|
| MP84 |
C. elegans |
dpy-5(e61) mec-6(lb84) I; unc-8(n491) IV. Show Description
Dpy.
|
|
| MT1085 |
C. elegans |
unc-8(n491) IV. Show Description
Coiler Unc. Dominant.
|
|
| MT1086 |
C. elegans |
unc-8(n492) IV. Show Description
Semi-dominant curly Unc.
|
|
| MT1175 |
C. elegans |
lin-25(n545) V. Show Description
Temperature sensitive: at 25C adult hermaphrodites are vulvaless, at 15C 8% of adult hermaphrodites are vulvaless.
|
|
| MT1584 |
C. elegans |
unc-8(e49) egl-19(n582) IV. Show Description
Unc. Egl.
|
|
| MT1600 |
C. elegans |
unc-8(e49) egl-21(n611) IV. Show Description
Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
|
|
| MT1652 |
C. elegans |
unc-8(n773) IV. Show Description
Semi-dominant Unc.
|
|
| MT1672 |
C. elegans |
unc-8(n491) dpy-4(e1166) IV. Show Description
Dpy. Unc.
|
|
| MT2136 |
C. elegans |
lin-3(n1058)/unc-8(e49) dpy-20(e1362) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Steriles (n1058 homozygotes). The n1058 homozygous larvae are occasionally paralyzed. Maintain by picking WT.
|
|
| MT2537 |
C. elegans |
dpy-13(e184) unc-8(n491) IV; him-5(e1490) V. Show Description
DpyUnc. e184 and n491 are both semi-dominant.
|
|
| MT2611 |
C. elegans |
unc-8(n491n1192) IV. Show Description
WT revertant.
|
|
| MT2612 |
C. elegans |
unc-8(n491n1193) IV. Show Description
WT. Intragenic revertant.
|
|
| MT2613 |
C. elegans |
unc-8(n491n1194) IV. Show Description
WT revertant.
|
|
| MT2614 |
C. elegans |
unc-8(n492n1197) IV. Show Description
WT revertant.
|
|
| MT2615 |
C. elegans |
unc-8(n492n1198) IV. Show Description
WT revertant.
|
|
| MT2616 |
C. elegans |
unc-8(n491n1195) IV. Show Description
WT revertant.
|
|
| MT2617 |
C. elegans |
unc-8(n491n1196) IV. Show Description
WT revertant.
|
|
| MT2618 |
C. elegans |
unc-8(n492n1199) IV. Show Description
WT revertant.
|
|
| NFB1692 |
C. elegans |
hlh-3(vlc28[hlh-3::mNeonGreen]) II. Show Description
vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
|
|
| NJ600 |
C. elegans |
exc-8(rh210) X. Show Description
Variable length excretory canal. Moderate, regional enlargement with occasional septations. Channel branches.
|
|
| OH15205 |
C. elegans |
otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15262 |
C. elegans |
otIs669 V. Show Description
otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15263 |
C. elegans |
otIs670 V. Show Description
otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15363 |
C. elegans |
otIs669 him-5(e1490) V Show Description
High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15430 |
C. elegans |
pha-1(e2123) III; otIs669 V. Show Description
Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15495 |
C. elegans |
otIs696. Show Description
otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15528 |
C. elegans |
him-5(e1490) V; otIs696. Show Description
High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH16289 |
C. elegans |
otIs696; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH16298 |
C. elegans |
him-8(e1489) IV; otIs670 V. Show Description
Him. [NOTE: strain does not segregate many male progeny.] otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OK245 |
C. elegans |
pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.
|
|
| OK286 |
C. elegans |
pyr-1(cu8) II. Show Description
Partially penetrant Mel.
|
|
| PB2801 |
C. brenneri |
Show Description
Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
|
|
| PS8365 |
C. elegans |
oac-8(sy1284) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-8;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTCGCGTTTCACTTTTTCCCTAAAACCTTCCCAAAT
Right flanking sequence: GGGTATATTGGAGTAGATATgtaggttgaaataaa
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCTACTCCAATATACCCATT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|