rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk17 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69A2AR.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok98 homozygotes (paralyzed, sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGTCTTTACATCCGTCATTTCTG. External right primer: CATGATCAATAGCCTTCACATCTC. Internal left primer: AAGCGTCCAAGGCACATATCG. Internal right primer: CGTCTTCAACGCCTCGGTAG. Internal WT amplicon: 3370 bp. Deletion size: approximately 1480 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55D10.3. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, WT males and homozygous gk4 hermaphrodites (arrest stage/phenotype undetermined). WT and Lon males invariably carry gk4 by PCR, but homozygous viable gk4 hermaphrodites have not been recovered. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F11A6.1a. Slow-growing, slightly small and slightly Unc in the head region. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W02A2.6. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok978 homozygotes (viable but too sick to maintain, segregates males). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459.

Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Increased angle of head bending. Maintain under normal conditions. Reference: Chen B, et al. J Neurosci. 2010 Dec 8;30(49):16651-61.