More Fields
Strain Species Genotype
RB1928 C. elegans exoc-8(ok2523) I. Show Description
Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2506 C. elegans Y67D8C.8(ok3469) IV. Show Description
Y67D8C.8 Homozygous. Outer Left Sequence: acgtgtcgtcatagtgtccg. Outer Right Sequence: ttttgtcgcaaattgaccag. Inner Left Sequence: tatttggcacgcttttcaga. Inner Right Sequence: cgaaagtcagaattgacaacattt. Inner Primer PCR Length: 1283. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3158 C. elegans +/mT1 [umnIs52] II; dhhc-8(ve658[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygotes are egg-laying defective, unhealthy. Deletion of 9372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 Egl-d adults (ve658 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgataatttaataaaacctctattccagtc ; Right flanking sequence: CGGACACCTTCCAGGACGGCGACGTCTCCA. sgRNA #1: tctgcatcagaccgaaattc; sgRNA #2: TAAATTCGAAATCCGGGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5004 C. elegans eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk3804 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC3837 and CGC48. gk3804 is a 717 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5005 C. elegans F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5455 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4374 and CGC48. gk5455 is a 2246 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5006 C. elegans stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5457 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4376 and CGC48. gk5457 is a 3229 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5007 C. elegans glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5468 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4390 and CGC48. gk5468 is a 5263 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5008 C. elegans tars-1(gk5534[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5534 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4460 and CGC48. gk5534 is a 2908 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAATGCATTAGAAGACGTGGGCGCGT. Right flanking sequence: TACGGGAGAGGCAGAGTGCACAGAGGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5009 C. elegans pdha-1(gk5568[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5568 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4497 and CGC48. gk5568 is a 1334 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATATTTACTGCTTTCAGTAGCTTGGTACA. Right flanking sequence: ATTGGAAGAGCTTAAACGACACGAATTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5010 C. elegans sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5542 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4469 and CGC48. gk5542 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGACTAATTAGTTTTGGTGTGTCCTCCG. Right flanking sequence: GACGTTCCCGAATCAACATCTCTCATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5011 C. elegans mecr-1(gk5557[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5557 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4485 and CGC48. gk5557 is a 1365 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCATGATCAATCTTCACATCACATTAAATT. Right flanking sequence: CGGAATTCGCACAGTTTACACAGATTTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5012 C. elegans pno-1(gk5573[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5573 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4502 and CGC48. gk5573 is a 3472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTGAATGGGTGAAGGGGCACTATATTGG. Right flanking sequence: TTTGGAGCAGTGTCCAAATTTTGCTCGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5013 C. elegans eif-2Bepsilon(gk5600[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5600 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4529 and CGC48. gk5600 is a 2890 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAATTTTGCAGATGCAATGACGCCCTACC. Right flanking sequence: CTTGTTATGACTGAAAGTTTTCAACCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5014 C. elegans eif-3.F(gk5606[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5606 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4535 and CGC48. gk5606 is a 1569 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTCGAATTTAACTGTCAATGTCCACCC. Right flanking sequence: CCCTCCCGAATTTGAAATTAGCGTTTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5015 C. elegans tpi-1(gk5612[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5612 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4541 and CGC48. gk5612 is a 3448 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCTGGGCTTGTTCTCCAGAAGCAGTCTT. Right flanking sequence: TTTGGCGAAAACTCGATTTTTTACCAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5016 C. elegans F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5677 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4607 and CGC48. gk5677 is a 2307 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5017 C. elegans tnc-2(gk5693[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5693 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4623 and CGC48. gk5693 is a 2787 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTTAGTCGGTTTTTCTGATATCCAGGT. Right flanking sequence: CATTCACTGACTTCCAATAATTCTTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RM1702 C. elegans ric-8(md303) IV. Show Description
Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C.
RM2209 C. elegans ric-8(md1909) IV. Show Description
Poor growth and fertility at 25C. Grows well at 20C and is more fertile than ric-8(md303). Degree of aldicarb resistance is similar to md303 but locomotion rate is greater than md303 and embryonic lethality is only 19%, versus 29% for md303. Contains a Tc1 transposon insertion in the middle of the ric-8 coding sequence.
SB129 C. brenneri Show Description
Male-female strain. Isolated in Bohorok, Sumatra from humus-like material probably from banana plants by P. Blum in June 1975. Conspecific with CB5161 by mating tests, and with CB5161, LKC28 and SB280 by RNA Polymerase II largest subunit sequence. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
SB280 C. brenneri Show Description
Male-female strain. Isolated by W. Sudhaus on Guadeloupe from rotting banana leaves on June 16, 1996. Conspecific with CB5161 by mating tests, and with CB5161, LKC28 and SB129 by RNA Polymerase II largest subunit sequence. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
SP1560 C. elegans mec-8(u218) I. Show Description
Temperature sensitive mec-8 allele.
SP1564 C. elegans mec-8(u218) smu-1(mn609) I; unc-52(e669su250ts) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP1750 C. elegans mec-8(u74) I; mnEx2. Show Description
mnEx2 [mec-8(+) + rol-6(su1006)]. Rollers. Pick rollers to maintain.
SP2123 C. elegans mec-8(u218) smu-1(mn602) I; unc-52(e669su250ts) II. Show Description
Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.
SP2230 C. elegans sym-2(mn617) II. Show Description
Wild type. Synthetically lethal with mec-8.
SP2231 C. elegans sym-3(mn618) X. Show Description
Wild type. Synthetically lethal with mec-8.
SP2232 C. elegans sym-4(mn619) X. Show Description
Wild type. Synthetically lethal with mec-8.
SP399 C. elegans dpy-10(sc48)/unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Uncs and Dpys which are left Rollers.
ST18 C. elegans mua-5(nc18)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST28 C. elegans ven-1(nc28) V. Show Description
Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.
SU896 C.elegans hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. Show Description
mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.
TJ1060 C. elegans spe-9(hc88) I; rrf-3(b26) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1061 C. elegans spe-9(hc88) I; emb-27(g48) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1062 C. elegans spe-9(hc88) I; rrf-3(b26) age-1(hx542) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ550 C. elegans spe-9(hc88) I; rrf-3(b26) II; gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C.
TU151 C. elegans mec-8(u303) I. Show Description
Mechanosensory abnormal.
TU166 C. elegans mec-8(u314) I. Show Description
Reference: Lundquist and Herman 1994 Genetics 138: 83.
TU218 C. elegans mec-8(u218) I. Show Description
Temperature sensitive. Mechanosensory abnormal at 25 C. Maintain at 15 C. Reference: Chalfie & Sulston (1981) Dev Biol 82:358.
TU3135 C. elegans mec-8(u218) I; rde-1(ne219) V; uIs46. Show Description
uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11.
TY4949 C. elegans spo-11(me44) rec-8(ok978)/nT1 IV; +/nT1[qIs51] V. Show Description
Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF, et al. Genes Dev. 2009 Aug 1;23(15):1763-78.
TY5121 C. elegans rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. Show Description
Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.
TY5124 C. elegans spo-11(me44) rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112)/nT1[qIs51] V. Show Description
Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.
UDN100022 C. elegans rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at 20 degrees. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100035 C. elegans rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100037 C. elegans rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100103 C. elegans rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100126 C. elegans rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. Show Description
udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658
UDN100145 C. elegans rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658