Touch insensitive; lethargic.

DNAse undetectable. M-MATING++++ >30%WT.

Coiler Unc. Dominant.

Slightly Unc. Lannate resistant. Recessive. Larvae Unc. M-MATING++ 1-10%WT.

Nuclei not anchored in certain epithelial cells.

Nuclei not anchored in certain epithelial cells.

Dpy. Nuclei not anchored in certain epithelial cells.

e1873 allele is the only anc-1 allele in which the molecular lesion has been identified (Starr and Han, 2002) and is considered by the authors to be the reference allele. e1873 does not revert, unlike most other alleles of anc-1. Reference: Hedgecock and Thomson. Cell. 1982 Aug;30(1):321-30. Starr and Han. Science. 2002 Oct 11;298(5592):406-9.

Severely Uncoordinated; Him; feminized at temperatures above 20C. Grow at 15C. Used for generating patroclinous WT males, by exploiting non-disjunction caused by him-8, and dominant sex-linked unc-1.

Slow growing. Homozygous gro-1(e2400) derived from PaC-1 (CB4507). Caenorhabditis elegans wild isolate CB subclone of PaC1 (Tc1 pattern IV?)].

Recessive. Kinker Unc.

Unc: recessive kinker.

Kinky Unc. Recessive. M-MATING++ 1-10%WT.

Continuously cultured in liquid CeMM for 4 years.

This strain was grown on CeMM (C. elegans Maintenance Medium) for 3 years (called CC1). It was then flown on STS-107, shuttle Columbia (and now called CC3).

Resistant to levamisole. Egl-d. Twitch at 25C. Long. Throws males.

rg1003 promotes development and male mating behavior on a chemically defined C. elegans maintenance medium (CeMM). Reference: Zhang L, et al. Nature Communications (2015) In press.

umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.

umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Dpy mKate2+. Derived by insertion of myo-2p::mKate2 transgene into parental strain BC4279 using CRISPR/Cas9.

Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.

Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.

Small body size. Crumpled spicules. Male ray 8-9 fusion.

Hypersensitive to volatile anesthetics. Temperature sensitive hypomorph and should be propagated at or below 20C. Low brood size.

ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

Highly resistant to ivermectin. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]

Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]

glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.

Antarctic nematode isolated from Ross Island, Antarctica in 1988. Panagrolaimus sp. DAW1 formerly known as Panagrolaimus davidi or P. davidi CB1. Survives freezing at -80 °C, including extensive intracellular freezing. Reference: Raymond MR, Wharton DA, Marshall CJ (2014) Antarc Sci 26:15-22.

Superficially wild type

Temperature sensitive lethal. Endocytosis defective. Maintain at 15C. AKA: rme-3.

Animals heterozygous for mnDp33 are WT and segregate WT and lethals. Animals which have lost mnDp33 arrest as two fold L1 larvae. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).

raEx176 [T05G5.1p::Y39A1C.1 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

Dauers SDS-sensitive. Unc.

Kinky Unc.

Temperature sensitive. Maintain at 15C. Formerly known as mat-2.

Temperature sensitive. Maintain at 15C. Formerly known as mat-2.

Homozygous viable. Weak Him phenotype (2-3%). Extremely sensitive to ionizing radiation and other DNA damaging agents.

oxTi902 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-1.50). Insertion into anc-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1661 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.

oxTi983 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + HygroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-14.58). Insertion into src-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1660 into N2 with hygromycin B selection.

Homozygous mutant animals give rise to >97% dead embyros at the restrictive temperature of 26C, with embryos exhibiting a lack of pronuclear migration at the one-cell stage. Homozygous mutant animals give rise to 50% dead embryos at the permissive temperature of 15C. Maintain at 15C.

Temperature sensitive. At 15C, 100% viable. At 26C, 2% viable. At 25C, 10% viable. Missense mutation R to C at position 1237 (nucleotide #3709: cgt to tgt). Reduced brood size after upshift. Received new stock 12/04.

Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.

Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Maintain at 15 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Maintain at 15 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

orIs17 [dhc-1p::GFP::dhc-1 + unc-119(+)]. N-terminal-tagged GFP::dhc-1 fusion driven by the dhc-1 promoter. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.