More Fields
Strain Species Genotype
VC450 C. elegans ras-1(gk243) II. Show Description
C44C11.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC476 C. elegans kcc-1(ok648) IV. Show Description
R13A1.2. Larvae Dpy; adults slow-growing, often Dpyish and Egl. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4795 C. elegans clc-1(gk5863[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1110 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CTTCTGAAAAAAATATTAAAATTAAAACCA. Right flanking sequence: TGGGGACGGCAAAAAATGTAACGGTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC48 C. elegans kpc-1(gk8) I. Show Description
F11A6.1a. Slow-growing, slightly small and slightly Unc in the head region. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC517 C. elegans bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
T19E7.3. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok691 homozygotes (viable and probably fertile, perhaps slow-growing). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC542 C. elegans kcc-1(ok692) IV. Show Description
R13A1.2. Often Dpyish; some animals sterile, some with vulval defects. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC626 C. elegans ceh-39(gk296) X. Show Description
T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC664 C. elegans ras-1(ok977) II. Show Description
C44C11.1. Superficially wild type. External left primer: GTCCAAGTCGTCAAGGCAAT. External right primer: GCAGGAAGATCGGTAAGCAC. Internal left primer: CCAAAGAAATCCCGTTTTGA. Internal right primer: ACGCTATAGCCTTCCCCAAT. Internal WT amplicon: 3114 bp. Deletion size: 1173 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC667 C. elegans swan-2(ok964) V/nT1 [qIs51] (IV;V). Show Description
F53C11.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok964 homozygotes (WT appearance, lays eggs that do not hatch). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC694 C. elegans ceh-39(gk307) X. Show Description
T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC695 C. elegans scc-1(ok1017)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10G7.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1017 homozygotes (Unc with variable arrest stage, late larva through adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC718 C. elegans cri-2(gk314) V. Show Description
K07C11.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC764 C. elegans hat-1(ok1265) III. Show Description
M03C11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC766 C. elegans ceh-39(gk329) X. Show Description
T26C11.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC796 C. elegans +/szT1 [lon-2(e678)] I; rbc-1(ok1112)/szT1 X. Show Description
F54E4.1. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok1112 homozygotes (mild Dpy, Unc, often with vulval defects; small broods with some eggs that don't hatch). WT males representing ok1112 hemizygotes may also be segregated. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC838 C. elegans cri-2(gk348) V/nT1 [qIs51] (IV;V). Show Description
K07C11.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk348 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC947 C. elegans vps-36(gk427) V/nT1 [qIs51] (IV;V). Show Description
F17C11.8. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk427 homozygotes (slow-growing, often sterile, mildly Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7046 C. elegans ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7154 C. elegans hsp-60 (hd7146 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7146 homozygotes), Dpy non-GFP mKate2+ sC1 homozygotes. Derived from parental strains VH7146 and CGC51. hd7146 is a 4918 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATTTATTCCTGTATTTTTCAGTCATTACCT; Right flanking sequence: GCAATTTTTTGTATGATTTTTCATCAATTT. sgRNA #1: TGCATTATCGTCTGGGAAGC; sgRNA #2: AGAAAACCGATAAAATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VS18 C. elegans maoc-1(hj13) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
VS19 C. elegans maoc-1(hj14) II. Show Description
Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
WBM132 C. elegans wbmEx49. Show Description
wbmEx49 [rab-3p::crtc-1(S76A, S179A)::tdTomato::unc-54 UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in neurons. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM184 C. elegans wbmEx69. Show Description
wbmEx69 [ges-1p::crtc-1(cDNA S76A, S179A)::tdTOMATO::unc-54 3'UTR]. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression in intestinal cells. Fluorescence may be difficult to see at lower magnifications. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM34 C. elegans uthIs205. Show Description
uthIs205 [crtc-1p::crtc-1::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged CRTC-1 expression from native promoter. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM55 C. elegans uthIs226. Show Description
uthIs226 [crtc-1p::crtc-1(S76A, S179A)::tdTOMATO::unc-54 3'UTR + rol-6(su1006)]. Rollers. tdTOMATO-tagged, non-phosphorylatable CRTC-1 expression from native promoter. Constitutively nuclear expression in neurons and intestine. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WH108 C. elegans abc-1(oj2) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs and abc-1 homozygotes. At 25C abc-1 homozygotes are sterile Unc animals. At 16C abc-1 homozygotes are fertile animals that produce all dead eggs.
WH257 C. elegans unc-119(ed3) III; ojIs5. Show Description
ojIs5 [pie-1p::GFP::dnc-1 + unc-119(+)]
WM186 C. elegans avr-14(ad1302) I; ttTi5605 II; unc-119(ed3) III; avr-15(ad1051) glc-1(pk54) V; neEx15. Show Description
neEx15 [myo-2::RFP + myo-2::avr-15(+) + unc-119(+)]. MosSCI recipient strain. neEx15 rescues unc-119, making the worms healthier for injection. The array is counter-selectable. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM215 C. elegans avr-14(ad1302) ego-1(om97) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM216 C. elegans avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM65 C. elegans src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
WRM1 C. elegans sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM2 C. elegans sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WRM3 C. elegans sprSi3 II; unc-119(ed3) III. Show Description
sprSi3 [mex-5p::GFP::histone-H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Fluorescence in the distal germline and in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
WU1036 C. elegans natc-1(am138) V. Show Description
natc-1(am138) mutant animals are resistant to excess dietary zinc, cadmium, nickel, and copper. natc-1(am138) animals are also resistant to excess heat and oxidative stress while displaying reduced lifespan. References: Warnhoff K, et al. PLoS Genet. 2014 Oct 16;10(10):e1004703. Bruinsma JJ, et al. Genetics. 2008 Jun;179(2):811-28.
WU982 C. elegans natc-1(am134) V. Show Description
natc-1(am134) mutant animals are resistant to excess dietary zinc. References: Warnhoff K, et al. PLoS Genet. 2014 Oct 16;10(10):e1004703. Bruinsma JJ, et al. Genetics. 2008 Jun;179(2):811-28.
XW13734 C. elegans unc-76(e911) V; qxIs612. Show Description
qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.
XW19180 C. elegans qxIs750. Show Description
qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.
XW5399 C. elegans unc-76(e911) V; qxIs257. Show Description
qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.
ZM11286 C. elegans hpIs636; hpEx4479. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. hpEx4479 [npr-4p::snb-1::pHluorin + lin-15(+)]. Pick animals with green fluorescence in VNC to maintain. Synapse exocytosis marker in AVA. Transgenic animals exhibit punctate green fluorescent signals along AVA neurites in the ventral cord, with stronger expression than in a wild-type background. mCherry and HisCl1 expression in AVA soma and neurites. In the presence of histamine, the SNB-1::pHluorin intensity will decrease in neurites.
ZM9354 C. elegans hpIs636. Show Description
hpIs636 [rig-3p::HisCl1::SL2::mCherry]. mCherry expression in AVA soma and neurites along VNC. Non-specific mCherry expression in gut. HisCl activation leads to reduced forward and reversal activity.
BC10031 C. elegans dpy-5(e907) I; sEx865. Show Description
sEx865 [rCesY43F8C.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10753 C. elegans dpy-5(e907) I; sEx10753. Show Description
sEx10753 [rCes Y57G11C.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14531 C. elegans dpy-5(e907) I; sEx14531. Show Description
sEx14531 [rCes Y57G11C.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14533 C. elegans dpy-5(e907) I; sEx14533. Show Description
sEx14533 contains [rCes Y57G11C.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15216 C. elegans dpy-5(e907) I; sEx15216. Show Description
sEx15216 [rCes Y51H7C.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15488 C. elegans dpy-5(e907) I; sEx15488. Show Description
sEx15488 [rCes Y45G12C.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CHS1206 C. elegans srt-19(yum2232) srt-20(yum2233) srt-22(yum2234) srt-15(yum2235) srt-16(yum2236) srt-17(yum2237) srt-18(yum2238) srt-23(yum2239) srt-24(yum2240) srt-59(yum2241) y55f3c.10(yum2242) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1252 C. elegans t10h9.1(yum2567) zc443.7(yum2568) y57a10c.10(yum2569) w05h5.1(yum2570) y57a10c.8(yum2571) f38h12.5(yum2572) y57a10c.9(yum2573) dct-12(yum2574) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.