Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).

Vulvaless due to the lin-7 allele. Non-null allele of agl-1; Gro and Diet/nutrition-dependent maternal effect embryonic lethal due. Reference: Simske JS, et al. (1999). Ventral enclosure in C. elegans: getting to the molecules presented in International C. elegans Meeting.

Maintain at 15C.  Temperature-sensitive embryonic lethal with defects in embryonic cytokinesis.  Suppressor of the lin-2 Vul phenotype

Reduced brood size. cey-3(rrr11) was created using TALENs in the cey-2(ok902) mutant background to produce the double mutant. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.

Slightly pale appearance. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.

K07C11.5. Homozygous. Outer Left Sequence: GAACGGCCTATGGTGACACT. Outer Right Sequence: TGAGCAGAACGAAAGGAGGT. Inner Left Sequence: GACAATTGTTTTTGGACGGG. Inner Right Sequence: CCGAGCAAATTTGGAAACAT. Inner Primer WT PCR product: 2642. Deletion size: 1680 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15C11.2a. Homozygous. Outer Left Sequence: AGCTGCTCTTGAACGGTTGT. Outer Right Sequence: TGAATAAAAGGGGAACGTCG. Inner Left Sequence: CAGGAGCCCTTGCTCAATAG. Inner Right Sequence: GCTTATTAAAGGGGCCGAAG. Inner Primer WT PCR product: 2991. Deletion size: 1147 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1236.2. Homozygous. Outer Left Sequence: AATTGTAGAACCATGGCCGA. Outer Right Sequence: AACATGTGCAACAATTCCGA. Inner Left Sequence: CGTTCGGTTTGAGATGGATT. Inner Right Sequence: AGATGAGAGGCGCAGACATT. Inner Primer WT PCR Product: 2703. Deletion size: 2221 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09H1.6a Homozygous. Outer Left Sequence: tttcaggaaccaccgaaaag. Outer Right Sequence: gtagcaaacaaaatgcgggt. Inner Left Sequence: cgaagagccaaagtcctacg. Inner Right Sequence: ggagcatcgttgtttcgttt. Inner Primer PCR Length: 3198. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.3 Homozygous. Outer Left Sequence: aaaatcgaaccacggtcttg. Outer Right Sequence: tctctgcgacaaatgtctgg. Inner Left Sequence: agggcacggaaatgtgatag. Inner Right Sequence: tactccctgtgtccctttgc. Inner Primer PCR Length: 2921. Deletion size: 905 bp. Left flank: AGGGGAAAAAGGGAAAAAACGGCTGAAATT. Right flank: TTTTTCCATTTCTAAACTCGCGTAGTTGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.2, T26C11.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26C11.4. Homozygous. Outer Left Sequence: CCAGACATTTGTCGCAGAGA. Outer Right Sequence: AATTCAAAGTTCCGCCAAGA. Inner Left Sequence: AGTATTGGCACGGACGAATC. Inner Right Sequence: CAGATGGACATCAGCCATTG. Inner Primer PCR Length: 3154 bp. Deletion Size: 870 bp. Deletion left flank: CATCGATGTTTGAGTGTTCTGAAAATGTGA. Deletion right flank: TCCTCCATTATAGCCGTCTGAATCCACATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C11.1. Homozygous. Outer Left Sequence: GGAAAACATCGTGTGCCTTT. Outer Right Sequence: GTCTCAAGGCGAGAAGTTGG. Inner Left Sequence: ATTTGCGCGAATAACTGGTC. Inner Right Sequence: GCCAAAGCTTATCCCATTGA. Inner Primer PCR Length: 2358 bp. Deletion Size: 1165 bp. Deletion left flank: AACCAACAATCATATTCCCACCGGCTGGTT. Deletion right flank: AATGAATTAAATCAAATTTCTGGAAATCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B4.2. Homozygous. Outer Left Sequence: GGCCAACAATCACCAATTTT. Outer Right Sequence: CGCATCCCCTAATTGACTGT. Inner Left Sequence: GTACGGAGGTATTCCGACGA. Inner Right Sequence: GCCATCACGCTTTGAAAGTT. Inner Primer PCR Length: 2286 bp. Deletion Size: 2036 bp. Deletion left flank: TATCGAAAAGGTATGTGCTTTTAAGAGCGT. Deletion right flank: TGCCGTCAAATAGTGTTGTTCCATACAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15C7.2 Homozygous. Outer Left Sequence: ttaaaaatgctgagggtggc. Outer Right Sequence: caatgggcaaagacgagaat. Inner Left Sequence: tggcaaatatcattgcagga. Inner Right Sequence: cggtgacgagagagtcacaa. Inner Primer PCR Length: 2903. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M7.2 Homozygous. Outer Left Sequence: aaatggcgccaagagatatg. Outer Right Sequence: tcacgcaattttgagttcgt. Inner Left Sequence: attgtcaggctgctggatct. Inner Right Sequence: cgattcaataattttcgggg. Inner Primer PCR Length: 2292. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92H12A.1 Homozygous. Outer Left Sequence: ctggcaccacgtgatatttg. Outer Right Sequence: tatccgctcacctctgcttt. Inner Left Sequence: catttacatggtggtgagcg. Inner Right Sequence: attcctcggcacataaccag. Inner Primer PCR Length: 2697. Deletion size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48C11. Homozygous. Outer Left Sequence: ATACCCGCCATCATCTCAAA. Outer Right Sequence: TATTTCGGTATCTGCCGAGC. Inner Left Sequence: TCAGCAGCACTTGACAAACA. Inner Right Sequence: AAAATGTTCTTGACGCGGAG. Inner Primer PCR Length: 3211 bp. Deletion Size: 1618 bp. Deletion left flank: AACCCAAGTTGCTACAAATCATTTGAAACA. Deletion right flank: TGCTTACAATGAACAATTGTGTCCCGGATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1. Homozygous. Outer Left Sequence: GGAATTGAGCATGTCAAGCA. Outer Right Sequence: GGGAATTCACCGAAAATCAA. Inner Left Sequence: TGCCGACATACAACAAGTTCA. Inner Right Sequence: CAAATCGGCAAATCGGTAAT. Inner Primer PCR Length: 1118 bp. Deletion Size: 373 bp. Deletion left flank: AACTCAATTCACAATACTCCTTTTAATTTC. Deletion right flank: ATGGCCACTGTGAGATTGGTACTAGTTAAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.2. Homozygous. Outer Left Sequence: ATGTGTGTGCTGCAAGAAGG. Outer Right Sequence: CGGAACGTCGCCTATAAAAA. Inner Left Sequence: GGTATTCAATCGCAGCGG. Inner Right Sequence: ATTCGGTTTGTCATCGCACT. Inner Primer PCR Length: 1325 bp. Deletion Size: 1048 bp. Deletion left flank: GACGTTGCTAACTGTGTTAATGCGTGTTTC. Deletion right flank: ATAATATTTCCTAAATTCTCTCATCTCAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y46H3C.1 Homozygous. Outer Left Sequence: ggaattgagcatgtcaagca. Outer Right Sequence: gggaattcaccgaaaatcaa. Inner Left Sequence: tgccgacatacaacaagttca. Inner Right Sequence: caaatcggcaaatcggtaat. Inner Primer PCR Length: 1117. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M03C11.3 Homozygous. Outer Left Sequence: aggtgctgttgagtcctgct. Outer Right Sequence: ttctctcctcgtccacgact. Inner Left Sequence: aaattccacaaaatccgctg. Inner Right Sequence: ccgggaacatccaaactg. Inner Primer PCR Length: 1090. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06H11.4. Received new stock 9/15/04. Homozygous. [NOTE: Seems to grow better at lower temperature (15C).] Outer Left Sequence: GGTCTGTTGCATGTGGTTTG. Outer Right Sequence: TTCGTCATCCCTCTTCATCC. Inner Left Sequence: TCTAAGCTGCAAACTCGCAA. Inner Right Sequence: AATCTGTTACCCTTGCTGCG. Inner primer WT PCR product: 3273. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31F6.6. Homozygous. Outer Left Sequence: ACACCGAACTTTATCAGGCG. Outer Right Sequence: TGGTAGGAGGAAAGCGAATG. Inner Left Sequence: ATTGCAGAGCCTCCAATCAT. Inner Right Sequence: TGATATGGTGACTGGGAGCA. Inner primer WT PCR product: 2815. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F5.5. Homozygous. Outer Left Sequence: AAATTGTGAAACCGCACACA. Outer Right Sequence: TTGCAGCTATCCTGAACACG. Inner Left Sequence: TTCGGTAAGCCAAGTTGGAG. Inner Right Sequence: GGCGAGCAGTAGCACACATA. Inner primer WT PCR product: 2594. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39D8C.1. Homozygous. Outer Left Sequence: ATGGACAGCGTGTCATACCA. Outer Right Sequence: TTTGGGTAAGTTGGGCTTTG. Inner Left Sequence: CGGCTCCGTCACTTCTATTC. Inner Right Sequence: GATCTCAAGAACCCCGACAA. Inner primer WT PCR product: 3226. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01C8.3. Homozygous. Outer Left Sequence: AACGGTGCATTTTTCAGGAC. Outer Right Sequence: GGACGTTGAGAATGCGAAAT. Inner Left Sequence: AAATGGTTTACGGGCTTGG. Inner Right Sequence: ATGGTTGGCCATGTTGAGAT. Inner Primer WT PCR product: 2713. Deletion size: 629 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous Mel. Deletion of 3345 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve611 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: GATCAATCGCTGGTCCAGAAGGTTCCACTA ; Right flanking sequence: TCAGGCCACCGATTTTTAGtctatatttta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

homozygous viable. Deletion of 641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgaagaaaaaaatagacagcatgactagac ; Right flanking sequence: gctggaacaatcacagtactacattactcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3804 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCTGGGAACTTCCAGGACTTGCCCATTTT ; Right flanking sequence: tgggcaataattggcgagaagttttttgga. sgRNA #1: TGCGAGCATATGCTATTCCT; sgRNA #2: aaaaaccaatgtttacagag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2121 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAGCAAATGTTTCAGTTAATGAATGAATA ; Right flanking sequence: GCCCTGTATAGTTTTCTGTCGGAATTTATA. arc-1 sgRNA #1: TGGTTGCAACGTGTGCAACG; arc-1 sgRNA #2: ATGTACCATTAAGACGACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5417 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGGCAAGCACACAGGTTCAATCACCAG ; Right flanking sequence: ACACTCTGATTGCTCAATTCATTCGCTACT. marc-1 sgRNA #1: AGAAACCAGTGAGACCGGCA; marc-1 sgRNA #2: ATACGTTGTTGAGAATTGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested early larvae (ve972 homozygotes, rare escapers are fertile adults), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GTCTTTCCATGAGCAACAATTTTACATCCT; Right flanking sequence: CGGCTTTTTTTACGGTTCctgaatacaaaa. rpc-1 crRNA A: AAAGTGTGTCCACAGATGAG; rpc-1 crRNA B: AATCTTCAGAACTGCTCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10915 [F17C11.1::H1-wCherry + unc-119(+)].

stIs11751 [nfyc-1::H1-wCherry + unc-119(+)].

CRISPR/Cas9 engineered tagged endogneous locus.

CRISPR/Cas9 engineered tagged endogneous locus.

CRISPR/Cas9 engineered tagged endogneous locus.