Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Slow pumping. High reversal frequency. Ivermectin resistant. This strain is a replacement for the strain DA1316 currently in the CGC stock and whose genotype is actually avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Weak Emb and Him. Reference: Li Q, et al. PLoS Genet. 2023 Jan 30;19(1):e1010457. doi: 10.1371/journal.pgen.1010457. PMID: 36716349.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Formerly known as mat-2. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.

Raise at 15C. Dpy Unc. unc-102(e1598) changed to unc-1(e1598). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Phenotypically WT. Isoelectric variant of ges-1 intestinal carboxylesterase.

Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.

vxEx282 [WRM0621dC07 + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Fosmid rescues ok415. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.

vxEx283 [mec-10p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in ALMl, ALMR, AVM, PLML, PLMR, FLP, and PVD. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx284 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx478 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

Unc. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.

Constipated. Long defecation cycle in mid to late adults.

Recessive Daf-c mutation that also causes Odr and Che defects. Maintain at 15C. [The mec-1 mutation present in the original isolates has been eliminated.] Previously known as daf-21.

mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.

louIs8 [ges-1p::nuc-1::mCherry::unc-54 3'UTR]. mCherry-tagged lysosomal nuclease NUC-1 expression can be used to monitor lysosomes in the gut. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dup carrying animals are Dpy-14. Animals which have lost the Dup are DpyDpy-> these are very short and very fat in the middle. Maintain by picking the Dpy animals that move well. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

hDp21-bearing animals have wild-type length Egl phenotype, and segregate Egl and Dpy-5 Dpy-14 progeny. Pick Egl animals and check for correct segregation of progeny to maintain. Presence of rec-1 confirmed by Mark Edgley 9/94. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

WT strain which segregates DpyUnc. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Wild-type phenotype. Segregates WT, Dpy-5 Dpy-14 Rec-1. Presence of rec-1 not confirmed. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Dpy-14 phenotype. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Dpy. Animals which have lost the duplication are extremely Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

WT. Dp carries Chromosome I and V left sequences. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Unc. Animals which have lost the duplications are DpyUnc and arrest at mid-larval development. Maintain by picking Unc non-Dpy. Previously called let-354(h79).