More Fields
Strain Species Genotype
UTK8 C. elegans cam-1(gm122) cwn-1(ok546) II; mbr-1(qa5901) X; utkEx3. Show Description
utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
UTK9 C. elegans cam-1(gm122) II; cwn-2(ok895) IV; mbr-1(qa5901) X;utkEx4. Show Description
utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
VC3632 C. elegans dbr-1(gk3614) I/hT2[bli-4(e937) let-?(q782) qIs48](I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3614 homozygotes (mid- to late-larval arrest, thin and slightly uncoordinated, sometimes with protruding vulval tissue). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
VC4369 C. elegans Y55F3BR.1(gk5450[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8878 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGTATTTCAGTCCCGAATCCTGCAAAAA; Right flanking sequence: CACTATTTTCTTATCAAATTCCGTGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4868 C. elegans Y48G1BR.1(gk5936[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3243 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTTGGTCAGTGACTTGATTTCAACATTCAC. Right flanking sequence: AAAATTGCAAAAATTAATTTATGTTTTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC762 C. elegans Y54E10BR.1&arx-7(ok1118) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54E10BR.1, M01B12.3. Homozygous lethal deletion chromosome balanced by bli-4- let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1118 homozygotes (early- to mid-larval arrest). Homozygous hT2[qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZM8230 C. elegans ubr-1(hp684) I. Show Description
hp684(Q1864X) mutant animals generate reversal movement with little flexing of the posterior body, and the stiffness is prominent during prolonged reversals. This phenotype is progressive, and most prominent when animals develop from the L4 stage larvae into adults. Reference: Chitturi JH, et al. PLoS Genetics. 2018;14(4):e1007303.
BC11735 C. elegans dpy-5(e907) I; sEx11735. Show Description
sEx11735 [rCesY82E9BR.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
RB1184 C. elegans Y82E9BR.14(ok1230) II. Show Description
Y82E9BR.14 Homozygous. Outer Left Sequence: ggggttcaggagggtaaaaa. Outer Right Sequence: atttgaagaatttcgcgtgc. Inner Left Sequence: cacgttaagccggaaattgt. Inner Right Sequence: gcgtcacggctagatttttc. Inner Primer PCR Length: 2829. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2135 C. elegans Y82E9BR.16(ok2740)/sC1 [dpy-1(s2170)] III. Show Description
Y82E9BR.16. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2740 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCTGGGGATTTTAGCG. External right primer: TATCACCACATTTCCCGTCA. Internal left primer: AATTTGAAAATTTTTGAGGTTTCAT. Internal right primer: TTTCGCGGAAATATTGAACTTT. Internal WT amplicon: 3097 bp. Deletion size: 1978 bp. Deletion left flank: TTTTTTCAAATCGTTGCTAAATTTGAATTT. Deletion right flank: GGGCTTTTTCAGCAATTTCCGGGTAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807