More Fields
Strain Species Genotype
VC4423 C. elegans B0244.5(gk5501[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAGCGTATGAACTGCTGGTAGGGGTTTTA; Right flanking sequence: TGGCCATATTTTTCCTGCAGTGCCGCACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1102 C. elegans b0244.10(yum1591) b0244.15(yum1592) b0244.16(yum1593) b0244.17(yum1594) b0244.4(yum1595) b0244.5(yum1596) b0244.7(yum1597) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.