More Fields
Strain Species Genotype
BC10482 C. elegans dpy-5(e907) I; sEx10482. Show Description
sEx10482[rCesY6B3B.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10717 C. elegans dpy-5(e907) I; sIs10503. Show Description
sIs10503 [rCesY71H2B.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BJS737 C. elegans mpk-1(sbj10) III. Show Description
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404.
BX10 C. elegans ads-1(wa3) III. Show Description
Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.
CB3243 C. elegans rab-10(e1747) III. Show Description
Homozygous viable and looks almost normal by dissecting scope, but under Nomarski microscopy the gut has a very abnormal spongy appearance, which is especially noticeable in L4 larvae.
CB3518 C. elegans mab-10(e1248) II; him-5(e1490) V. Show Description
Hermaphrodtes segregate impotent males. Males show very slight swelling of bursa.
CB698 C. elegans vab-10(e698) I. Show Description
Head abnormal-bent. Variable penetrance. Other abnormalities.
CZ22695 C. elegans juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22698 C. elegans juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22703 C. elegans juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23277 C. elegans juEx7101. Show Description
juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23279 C. elegans juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
CZ23281 C. elegans juEx7105. Show Description
juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
KK26 C. elegans unc-4(e120) ooc-3(b310)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4 which give dead eggs. Maintain by picking WT. Strict maternal effect.
LE2685 C elegans egl-20(lq42) lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. PQR migration defects: PQR in the head in the normal position of AQR. lq42 is a premature stop codon in egl-20. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Josephson M, et al. PLos One. 2016 Feb 10;11(2):e0148658. doi: 10.1371/journal.pone.0148658. PMID: 26863303.
LE2791 C. elegans lqIs170 X. Show Description
lqIs170 [F25B3.3p::vab-10(ABD)::GFP + ttx-3::RFP] X. Pan-neuronal GFP expression. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
LE3845 C. elegans rdvIs1 III; egl-20(gk453010) IV; lqIs58 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.
ML1735 C. elegans mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Reference: Gally C, et al., Development. 2009 Sep;136(18):3109-19.
ML653 C. elegans vab-10(mc44)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and dead eggs and larvae with severe body morphology defects that do not develop beyond the L2 stage. A few very rare mc44 larvae reach adulthood but they become sterile. mc 44 is a deletion affecting the downstream transcription unit of vab-10 named vab-10b. Fails to complement the vab-10 null reference allele vab-10(h1356), but complements the vab-10a alleles vab-10a(e698) and vab-10a(ju281).
ML691 C. elegans vab-10(ok817)/unc-75(e950) unc-101(m1) I. Show Description
Heterozygotes are WT and segregate WT, Uncs, and severely Lumpy arrested L1s (ok817). m1 can easily get lost through recombination.
ML916 C. elegans mcIs40. Show Description
mcIs40 [lin-26p::ABDvab-10::mCherry + myo-2p::GFP]. Reference: Gally C, et al. Development. 2009 Sep;136(18):3109-19.
MSB510 C elegans mirIs37. Show Description
mirIs37 [acr-5p::CRE + myo-2p::mCherry]. Superficially wild-type. CRE expression is driven predominantly in B-type motor neurons; CRE activity has also been observed in a few other cells. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
MT20298 C. elegans nIs408 I; nIs454 II. Show Description
nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. nIs454 [mab-10p::mab-10::GFP + ttx-3p::GFP] II. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.
MT682 C. elegans nDf4/lin-31(n301) bli-2(e768) II. Show Description
Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. Received new stock from Horvitz lab 10/97.
NA13 C. elegans gus-1(b410) I. Show Description
5% of the wild type b-glucuronidase activity.
NA404 C. elegans him-8(e1489) qui-1(gb404) IV. Show Description
Quinine avoidance defective. In qui-1(gb404) a CAA to TAA transition at position 11215 of Y45F10B generates a stop codon in the fifth exon of Y45F10B.10. Putative null allele.
OH15542 C. elegans pha-1(e2123) III; otEx7233. Show Description
otEx7233 [inx-19(extended fosmid WRM0632bE10)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
PB110 C. briggsae Cbr-him(bd104) A; Cbr-dpy(bd101) X. Show Description
From C. briggsae G16. Chubby. 8% of self-progeny are males.
QQ251 C. elegans vab-9(ju6) II; mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.
RB2471 C. elegans dsl-3(ok3411) IV. Show Description
Y41D4B.10 Homozygous. Outer Left Sequence: gcaaattcggcaaatctctt. Outer Right Sequence: atacccctttccaaaaaccg. Inner Left Sequence: ttgccgtgcttaacaaactc. Inner Right Sequence: atgaagtcacaggtgacaaaaa. Inner Primer PCR Length: 1353. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2563 C. elegans qui-1(ok3571) IV. Show Description
Y45F10B.10 Homozygous. Outer Left Sequence: gcagcaggcataaagtaggc. Outer Right Sequence: aatagccaacgtgctaaccg. Inner Left Sequence: tctcgcagggtataaaacgg. Inner Right Sequence: gagccatcaatcctcccat. Inner Primer PCR Length: 1127. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB710 C. elegans F44D12.1(ok484) IV. Show Description
F44D12.1. Homozygous. Outer Left Sequence: AAGAGAGGGATCGACTGCAA. Outer Right Sequence: AGGCAATGAGACGACGGTAG. Inner Left Sequence: AAACTGCTCAGGCAAATGCT. Inner Right Sequence: CCTTGAGCCGTGATATCCAT. Inner primer WT PCR product: 2735. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB810 C. elegans R07E5.3(ok622) III. Show Description
R07E5.3, R07E5.14. Homozygous. Outer Left Sequence: ATTATTGTGATACCGGGCCA. Outer Right Sequence: AATTGAGAAGAGCGAGCGAG. Inner Left Sequence: CTACGCGAAACGGATCAAAT. Inner Right Sequence: CGTGGATTGGAGAGGACAAT. Inner primer WT PCR product: 2877. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB910 C. elegans elo-3(ok777) IV. Show Description
D2024.3 Homozygous. Outer Left Sequence: CATTGTTTTGTCGCCTCCTT. Outer Right Sequence: GCCTCTGATGATTAGCCGAA. Inner Left Sequence: ATCGACAACATGGATGCAAA. Inner Right Sequence: ACACAAATCGTCTCTTCCGC. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RT17 C. elegans rab-10(dx2) I. Show Description
Temperature sensitive. Maintain at 15C.
RT2 C. elegans rab-10(q373) I. Show Description
Large intestinal vacuoles.
RT525 C. elegans unc-119(ed3) III; pwIs206. Show Description
pwIs206 [vha6p::GFP::rab-10 + Cbr-unc-119(+)].
SZ340 C. elegans smg-4(az152) V. Show Description
CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
SZ345 C. elegans unc-73(e936az30) dxbp-1(az121) I; smg-4(az152) V. Show Description
dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
SZ355 C. elegans unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. Show Description
az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
VC1026 C. elegans rab-10(ok1494) I. Show Description
T23H2.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC117 C. elegans vab-10(gk45) I. Show Description
ZK1151.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2265 C. elegans C01G12.5&nspb-10(ok2910) II. Show Description
C01G12.6, C01G12.5. External left primer: AAATCAGTTATTGCTGCGCC. External right primer: AATGGAAAAATGATGTCGGG. Internal left primer: CTCTGAGCATTTCTTCCCGT. Internal right primer: TGGAACAAAATGTCGAAGAGC. Internal WT amplicon: 1250 bp. Deletion size: 889 bp. Deletion left flank: ATAATTATTTTCACAGCCAAATTAAACAGA. Deletion right flank: GAATAACCAGTATTTTATTTACATTGGCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2521 C. elegans +/mT1 II; Y39E4B.10(ok2517)/mT1 [dpy-10(e128)] III. Show Description
Y38E4B.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTTTGGCCTAAAAATCGCA. External right primer: ACCACATCCAATGCACAAGA. Internal left primer: CGCGGAGCAACTGATTTTAT. Internal right primer: TTCACTGGGCAAGCTCTTTT. Internal WT amplicon: 2301 bp. Deletion size: 1379 bp. Deletion left flank: TTTTAACATTAAAAATGATCTATATTTACC. Deletion right flank: GTTTTCCATCCAATTTCATTGATTTTTGAG. Insertion Sequence: TATATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4730 C. elegans rpb-10(gk5798[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 530 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAGCAAAATCACAAGATGATTATCCCAAT. Right flanking sequence: GTCAGACTGTCTATCATTCTGACGTCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC601 C. elegans vab-10(ok817) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK1151.1b. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok817 homozygotes (variable arrest stage; larvae often Dpy with lumpy tail and lumpy or notched head; adults often explode or disintegrate). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC707 C. elegans lagr-1(gk310) I. Show Description
Y6B3B.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC747 C. elegans lagr-1(gk327) I. Show Description
Y6B3B.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC765 C. elegans lagr-1(gk331) I. Show Description
Y6B3B.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7121 C. elegans Y71A12B.10(hd7121[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCGGAGACACTACACCTTCGAGACTCCT; Right flanking sequence: TGGTGCTCAATGTGCAGTGGCGTTTGGCTC. sgRNA #1: TCTTCAGTATATCCATTCGG; sgRNA #2: CGACTTGACGCTCATCGACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.