unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.

Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

juIs550 [mec-4p::mito::GCaMP5 + ttx-3p::RFP]. Mitochondrial calcium reporter expressed in touch neurons. Reference: Tang NH, et al. Curr Biol. 2020 Mar 9;30(5):865-876.e7. doi: 10.1016/j.cub.2019.12.061. PMID: 31983639

GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.

muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]

juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.

Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.

Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.

juIs176 [IFB-1a::GFP + rol-6(su1006)]. Some worms don't roll. GFP expression patterns are similar to MH4 staining.

Low penetrance tail Vab and embryonic lethality.

Cold sensitive lethal. Vab at 20 and 25C.

juEx595 [IFB-1b::GFP + rol-6(su1006)]. Maintain by picking Rollers. GFP expression patterns are similar to MH4 staining. Maintain by picking rollers.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal). pka efn-1.

Intermediate Vab-1 phenotype. About 9% embryonic lethality and about 20% larval lethality. CB699 outcrossed 2X to N2 to make CZ414.

Abnormal head morphology, slightly temperature sensitive. Maintain under normal conditions. Reference: Tong A, et al. Proc Natl Acad Sci U S A. 2009 Feb 3;106(5):1457-61.

Heterozygotes segregate wild-type heterozygotes, Emb, and Unc Dpy. Maintain by picking wild-type.

Incompletely penetrant embryonic lethal at three-fold. Mild Mua. Abberant head epidermal morphology. PKA vab-21.

Temperature-sensitive. Maintain at 15C. Vab. Lethal at 25C. 2-fold Lpy. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.

juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930.

Low penetrance tail vab (3-5%). Low penetrance embryonic lethality (3-5%). Low penetrance larval lethality (3%).

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

juEx1111 [spon-1::vGFP]; rescues ju402 lethality. Vab. 2-fold Lpy. ju402 is lethal. Reference: Woo WM, et al. Development. 2008 Aug;135(16):2747-56.

Muv.

juIs24 [vab-1::GFP + lin-15(+)]. GFP very faint. Overtly WT.

vab-1 null phenotype. e2027 is a 74 bp deletion allele.

juIs52 [vab-2::GFP + rol-6(su1006)]. Rescuing GFP-tagged VAB-2 transgene. Rollers. vab-2 formerly known as efn-1.

Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.

Unc. Semi-dominant Eat (TB relaxation defective).

ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1077, heterozygotes are Egl. Strain throws Lon Males.

ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2 (a.k.a. eat-11). In DA1096, heterozygotes are Egl. Throws Lon males.

adIs1240 [eat-4::sGFP + lin-15(+)] X.

adEx1241 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature-sensitive.

adEx1242 [eat-4(+) + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv and Eat. n765 is temperature sensitive.

adIs1240 [eat-4::sGFP + lin-15(+)] X.

adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.

adEx1262 [gcy-5::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1266 [gcy-12::GFP + lin-15(+)]. Maintain by picking non-Muv. Very weak GFP signal. n765 is temperature-sensitive.

adEx1267 [gcy-8::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1269 [odr-1::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1276 [gcy-?::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1288 [gcy-7::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.

adEx1290 [gcy-33::GFP + lin-15(+)]. Maintain by picking non-Muv. gcy-33::GFP in BAG. n765 is temperature-sensitive.

adEx1292 [R01E6.1_8k::GFP + lin-15(+)]. Maintain by picking non-Muv. n765 is temperature-sensitive.