kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs104 [str-1p::GFP] X. AWB expression of GFP.

kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs121 [unc-115::GFP + lin-15(+)]; autosomal. Maintain under normal conditions. Reference: Lundquist E, et al. (1998) Neuron 21(2):385-92.

kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.

Coily movement; aberrent head movement. The AWB neurons are transformed towards the AWC neuron fate by many criteria.

slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.

kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.

668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.

kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].

bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.

Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.

bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.

bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.

rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions

Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.

juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.

juEx4796 [col-19p::mito::GFP + ttx-3p::RFP]. Pick animals with red fluorescence to maintain array. Transgenic animals express mito::GFP in the hypodermis. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012.

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.

juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.

juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.

juSi271 [col-19p::mito::Dendra2]. Superficially wild-type with altered mitochondrial morphology. Fluorescent reporter labels hypodermal mitochondria. Reference: Xu S, et al. J Genet Genomics. 2016 Feb 20;43(2):103-6.

bx80 was previously called mab-26(bx80): Extensive ray fusion involving all 9 rays; Larva have Vab phenotype with decreasing expressivity in adult; Hermaphrodites have swollen tail and anus. Vab, embryonic ventral enclosure defects, male ray fusions. Slow growth.

juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.

juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]

juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.

muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420

ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous dhc-1 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged dhc-1 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.

Aldicarb resistant. Reference: McCulloch KA, et al. G3 (Bethesda). 2017 Jul 5;7(7):2055-2063.

Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.

Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.

vab-2(ju1) has embryonic lethality (12%) and notched heads (about 40%). vab-2(ju1) is considered a null allele (W30opal), and was previously called efn-1. Vab, embryonic ventral enclosure defects, male ray fusions.

Superficially wild-type. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

juIs550 [mec-4p::mito::GCaMP5 + ttx-3p::RFP]. Mitochondrial calcium reporter expressed in touch neurons. Reference: Tang NH, et al. Curr Biol. 2020 Mar 9;30(5):865-876.e7. doi: 10.1016/j.cub.2019.12.061. PMID: 31983639

GFP reporter inserted into C-terminus of endogenous micu-1 locus. Diffuse GFP signals throughout the body. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.

Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.

muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]

juIs167 [vab-19::GFP + rol-6(su1006)]. Integrated by UV/TMP. Rollers. Received new stock Feb 2005.

juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.

Strong Vab-1 phenotype. About 50% embryonic lethality and about 30% larval lethality. Genetic null.

Vab. Notched Head. Distal tip cell Mig. Male tail ray and spicule defects. Males do not mate. About 50% larval lethality. H and B cell lineage defects. Received new stock Jan. 2006.