Hermaphrodites have abnormal truncated or blebbed tails, pale appearance, some excretory cell abnormalities, especially in adults. Males have variably abnormal tails, some are able to mate.

Vab XX hermaphrodites and XO males, viable at all temperatures. Adult hermaphrodite tail spike is invariably shortened and/or vacuolated, often also abnormal in larvae. Possible excretory cell abnormalities. Rays of adult male tail variably abnormal, other structures normal; males can mate.

fox-1(e2643) is a 1.2 kb deletion of fox-1; functional null. Hermaphrodites and males are WT in gross phenotype, slightly abnormal in hermaphrodite fertility and male mating. Synergistic masculinizing effects with some X chromosome deletions.

Resistant to infection by Microbacterium nematophilum (no tail swelling). Slightly skiddy, fragile cuticle, bleach sensitive, hypersensitive to drugs. Abnormal lectin staining.

eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.

Viable allele. Hypersensitive to many drugs.

Viable slightly dumpy hermaphrodites, drug and bleach sensitive, resistant to M. nematophilum (Bus phenotype) and Leucobacter Verde1, hypersensitive to Leucobacter Verde1. References: Partridge et al. (2008) PMID: 18395708. Hodgkin et al. (unpublished, in preparation).

Viable allele. Hypersensitive to many drugs.

Cold-sensitive lethal allele. Viable at >18C. Strongly hypersensitive to many drugs.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).

Notched head. Recessive. 100% Penetrance. Male spicules abnormal. M-MATING-NO SUCCESS. See also WBPaper00002236.

Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).

Most L1 larvae are deformed with irregular shapes. Older larvae and adults exhibit variably bent-head. Resembles spon-1(e2623) II. Homozygous viable, but inviable as hemizygotes (e1210/maDf2). Reference: Hodgkin (unpublished).

Notched head. Roller. Variably DpyRoller. Tail abnormalities. M-MATING++ 1-10%WT.

Head abnormal-bent. Variable penetrance. Other abnormalities.

eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation).

Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).

Skiddy, bleach-sensitive, drug-sensitive. Resistant to infection by Leucobacter Verde1 and Leucobacter Verde2. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

Small, skiddy, slow-growing, bleach-sensitive; resistant to Leucobacter Verde1. Intragenic pseudorevertant of bus-8(lj22), P63L = KLHPGDWW> KLHLGDWW. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation).

eEx763 [bus-8(exon2stop) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(ok1175) rescued by modified bus-8(+) transgene. Reference: O'Rourke et al (in preparation).

Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Reference: Yook K, Hodgkin J. Genetics. 2007 Feb;175(2):681-97.

eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

Very slow-growing, grows best at 25C. Small, bleach-sensitive, Bus, resistant to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).

Q288Stop(UAA). Reference null. Surface abnormal, resistant to M. nematophilum and Leucobacter Verde2, killed by Leucobacter Verde1. References: Darby C, et al. Genetics. 2007 May;176(1):221-30. doi: 10.1534/genetics.106.067496. Epub 2007 Mar 4. PMID: 17339204. O’Rourke D, et al. G3 (Bethesda). 2023 May 2;13(5):jkad056. doi: 10.1093/g3journal/jkad056. PMID: 36911920.

M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.

Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).

Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.

cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.

No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130

Isolated in 1991 by Carlos E. Winter in soil samples taken at the University of Sao Paulo in Brazil. Hermaphrodite strain. Adults are 1.5mm. The life cycle is a little longer than C. elegans at 22C. Each lays about 300 eggs in the three days following the moult from L4 to adult. Eggs are laid just after being fertilized resulting sometimes in plates with many eggs (much more than C. elegans). See Comp. Biochem. Physiol 103B: 189, 1992. See Nematology 2(1): 89-98, 2000. Can be grown and maintained on NGM. L1s easily frozen and stored in liquid nitrogen. This strain is deposited in Paul Sternberg's collection under the name PS1022. The species has not yet been determined; Lynn Carta will publish a paper proposing Oscheius brevesophaga. DO NOT use this name before the paper is published. Contact Carles E. Winter or Lynn Carta before publishing anything official about this strain. See also WBPaper00004471 and WBPaper00004485. AKA Oscheius sp. 1.

muIs62 [mig-13p::mig-13::GFP + lin-15(+)].

muIs3 [mab-5::lacZ + rol-6(su1006)] V. Rollers.

muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs126 [myo-3p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Gamma irradiation-induced integration of muEx215. Rescues daf-16a1/c in muscles (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

muIs139 [dod-11p::RFP::NLS + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

muEx336 [mtl-1::RFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.

muIs142 [ges-1p::GFP::daf-16(cDNA) + odr-1p::RFP]. Maintain at 15-20C. Gamma irradiation-induced integration of muEx268. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.

sIs10314 [rCesC06B3.4::GFP + pCeh361]. Strain was generated by outcrossing to remove dpy-5 from BC12544. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.

Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.

sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.