More Fields
Strain Species Genotype
CB4851 C. elegans C. elegans wild isolate. Show Description
Wild type-slightly Unc. Tc1 pattern high copy; different from RW7000. Bergerac isolate obtained by S. Brenner from Brun group. Caenorhabditis elegans wild isolate. CB subclone of Bergerac N62 (Tc1 pattern HCB). To obtain ECA243, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB4852 C. elegans C. elegans wild isolate. Show Description
Wild type. Low Tc1 copy number; pattern X. [Obtained from Rothamsted by S. Brenner as 'Panagrellus redivivus'. Cross fertile with C. elegans N2.] Caenorhabditis elegans wild isolate. CB subclone of N3 (Tc1 pattern X). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB4853 C. elegans C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1; pattern III. Caenorhabditis elegans wild isolate. CB subclone of GA-12 (Tc1 pattern III). To obtain ECA245, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB4854 C. elegans C. elegans wild isolate. Show Description
Isolated from Carl Johnson's organic garden in Altadena, CA in 1974. Wild type. Low copy Tc1, pattern V. Caenorhabditis elegans wild isolate. CB subclone of GA-9 (Tc1 pattern V). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB4855 C. elegans C. elegans wild isolate. Show Description
NOTE: Whole-genome analysis indicates that this stock is genotypically CB4858. Users interested in this strain are encouraged to obtain a verified CB4855-derivied strain. To obtain ECA247, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org). Isolated from compost in Palo Alto, CA in 1982(?). Wild type (plg-1(e2001)). Low copy Tc1, pattern VI. Caenorhabditis elegans wild isolate CB subclone of Sta-5 (Tc1 pattern VI). Original stock isolated by T. Doniach.
CB4856 C. elegans C. elegans wild isolate. Show Description
Isolated from a pineapple field in Hawaii in 1972 by L. Hollen. Wild type. Low copy Tc1; pattern IX. C. elegans wild isolate. CB subclone of HA-8 (Tc1 pattern IX). See also WBPaper00005369. [NOTE (4-2014): Users reported abnormalities in CB4856 in late 2013 and early 2014. The current working stock at the CGC was thawed in 2-2014 from stock frozen in 1995.] For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB4857 C. elegans C. elegans wild isolate. Show Description
Isolated from decaying mushroom during rain in Claremont, CA in November 1972. Wild type. Low copy Tc1, pattern II. Reference WBG 10(2) 140-141 and 11(5) 60. Caenorhabditis elegans wild isolate. CB subclone of Cl2a (Tc1 pattern II). To obtain ECA249, a sequenced isolate of this wild strain, or other whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
CB5145 C. elegans vab-14(e2610) X. Show Description
Hermaphrodites have abnormal truncated or blebbed tails, pale appearance, some excretory cell abnormalities, especially in adults. Males have variably abnormal tails, some are able to mate.
CB5330 C. elegans vab-12(dx25) III; him-8(e1489) IV. Show Description
Vab XX hermaphrodites and XO males, viable at all temperatures. Adult hermaphrodite tail spike is invariably shortened and/or vacuolated, often also abnormal in larvae. Possible excretory cell abnormalities. Rays of adult male tail variably abnormal, other structures normal; males can mate.
CB5380 C. elegans fox-1(e2643) X. Show Description
fox-1(e2643) is a 1.2 kb deletion of fox-1; functional null. Hermaphrodites and males are WT in gross phenotype, slightly abnormal in hermaphrodite fertility and male mating. Synergistic masculinizing effects with some X chromosome deletions.
CB6055 C. elegans bus-8B(e2698) X. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling). Slightly skiddy, fragile cuticle, bleach sensitive, hypersensitive to drugs. Abnormal lectin staining.
CB6144 C. elegans dpy-31(e2770) III; eEx512. Show Description
eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.
CB6147 C. elegans bus-8B(e2882) X. Show Description
Viable allele. Hypersensitive to many drugs.
CB6177 C. elegans bus-8B(e2883) X. Show Description
Viable slightly dumpy hermaphrodites, drug and bleach sensitive, resistant to M. nematophilum (Bus phenotype) and Leucobacter Verde1, hypersensitive to Leucobacter Verde1. References: Partridge et al. (2008) PMID: 18395708. Hodgkin et al. (unpublished, in preparation).
CB6193 C. elegans bus-8B(e2885) X. Show Description
Viable allele. Hypersensitive to many drugs.
CB6208 C. elegans bus-8B(e2887) X. Show Description
Cold-sensitive lethal allele. Viable at >18C. Strongly hypersensitive to many drugs.
CB6216 C. elegans bus-8B(e2887) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.
CB6253 C. elegans bus-8B(e2992) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).
CB648 C. elegans vab-3(e648) X. Show Description
Notched head. Recessive. 100% Penetrance. Male spicules abnormal. M-MATING-NO SUCCESS. See also WBPaper00002236.
CB6921 C. elegans bus-10 & ZK596.4 & ZK596.5 & ZK596.1(e2737) IV. Show Description
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).
CB6965 C. elegans vab-18(e1210) X. Show Description
Most L1 larvae are deformed with irregular shapes. Older larvae and adults exhibit variably bent-head. Resembles spon-1(e2623) II. Homozygous viable, but inviable as hemizygotes (e1210/maDf2). Reference: Hodgkin (unpublished).
CB697 C. elegans vab-6(e697) III. Show Description
Notched head. Roller. Variably DpyRoller. Tail abnormalities. M-MATING++ 1-10%WT.
CB698 C. elegans vab-10(e698) I. Show Description
Head abnormal-bent. Variable penetrance. Other abnormalities.
CB7148 C. elegans him-5(e1490) V; bus-8B(tm1410) X; eEx763. Show Description
eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation).
CB7171 C. elegans tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). Show Description
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).
CB7176 C. elegans bus-8A(lj22) dhs-29(e3066) X. Show Description
Skiddy, bleach-sensitive, drug-sensitive. Resistant to infection by Leucobacter Verde1 and Leucobacter Verde2. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).
CB7177 C. elegans bus-8A&B(lj22e3067) X. Show Description
Small, skiddy, slow-growing, bleach-sensitive; resistant to Leucobacter Verde1. Intragenic pseudorevertant of bus-8(lj22), P63L = KLHPGDWW> KLHLGDWW. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).
CB7181 C. elegans bus-8B(e2883e3071) X. Show Description
Weak Bus, viable on Leucobacter Verde1. e3071 is a missense intragenic revertant (P97S) of e2883 (G378E). Reference: Stroud et al (in preparation).
CB7259 C. elegans bus-8B(ok1175) X; eEx763. Show Description
eEx763 [bus-8(exon2stop) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(ok1175) rescued by modified bus-8(+) transgene. Reference: O'Rourke et al (in preparation).
CB7431 C. elegans bus-17(br2) X. Show Description
Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Reference: Yook K, Hodgkin J. Genetics. 2007 Feb;175(2):681-97.
CB7471 C. elegans unc-119(ed3) III; bus-8A(lj22) X; eEx861. Show Description
eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).
CB7538 C. elegans lon-2(e678) bus-8B(ok1176) X. Show Description
Very slow-growing, grows best at 25C. Small, bleach-sensitive, Bus, resistant to Leucobacter Verde1. Reference: O'Rourke et al (in preparation).
CB7549 C.elegans bus-4(br4) IV. Show Description
Q288Stop(UAA). Reference null. Surface abnormal, resistant to M. nematophilum and Leucobacter Verde2, killed by Leucobacter Verde1. References: Darby C, et al. Genetics. 2007 May;176(1):221-30. doi: 10.1534/genetics.106.067496. Epub 2007 Mar 4. PMID: 17339204. O’Rourke D, et al. G3 (Bethesda). 2023 May 2;13(5):jkad056. doi: 10.1093/g3journal/jkad056. PMID: 36911920.
CB791 C. elegans unc-5(e791) IV. Show Description
Superficially wild-type. References: Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Curr Biol. 2021 Apr 12;31(7):1508-1514.e5. doi: 10.1016/j.cub.2021.03.008. Epub 2021 Mar 18. PMID: 33740427. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
CB933 C. elegans unc-17(e245) IV. Show Description
M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
CB96 C. elegans vab-2(e96) IV. Show Description
Notched head. Tail abnormalities. Variable expression. Incomplete penetrance. Especially seen in L1. M-MATING++++ >30%WT. See also WBPaper00003843 and WBPaper00003865. Previously called efn-1(e96).
CER123 C. elegans ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.
CER244 C. elegans ikb-1(cer9) I. Show Description
cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER444 C. elegans sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CER554 C. elegans comt-4(cer157[comt-4p::GFP::H2B]) V. Show Description
No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CER588 C. elegans cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
CEW1 Oscheius tipulae Oscheius tipulae. Show Description
Isolated in 1991 by Carlos E. Winter in soil samples taken at the University of Sao Paulo in Brazil. Hermaphrodite strain. Adults are smaller than C. elegans. The life cycle is a little longer than C. elegans at 22C. Each lays about 300 eggs in the three days following the moult from L4 to adult. Eggs are laid just after being fertilized resulting sometimes in plates with many eggs (much more than C. elegans). See Comp. Biochem. Physiol 103B: 189, 1992. See Nematology 2(1): 89-98, 2000. Can be grown and maintained on NGM. L1s easily frozen and stored in liquid nitrogen. This strain is deposited in Paul Sternberg's collection under the name PS1022. The species has not yet been determined; Lynn Carta will publish a paper proposing Oscheius brevesophaga. DO NOT use this name before the paper is published. Contact Carles E. Winter or Lynn Carta before publishing anything official about this strain. See also WBPaper00004471 and WBPaper00004485. AKA Oscheius sp. 1.
CF1259 C. elegans mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. Show Description
muIs62 [mig-13p::mig-13::GFP + lin-15(+)].
CF196 C. elegans muIs3 V. Show Description
muIs3 [mab-5::lacZ + rol-6(su1006)] V. Rollers.
CF2005 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs120. Show Description
muIs120 [ges-1p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Long-lived. Gamma irradiation-induced integration of muEx211. Rescues daf-16a1/c in the intestine (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.
CF2018 C. elegans muEx304. Show Description
muEx304 [lys-7p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2037 C. elegans muEx311. Show Description
muEx311 [pep-2p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. pep-2 is an other name for pept-1. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2038 C. elegans muEx312. Show Description
muEx312 [dod-17p::RFP(NLS) + rol-6(su1006)]. Pick Rollers to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
CF2093 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs131. Show Description
muIs131 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Maintain at 15-20C. Rollers. Modestly long-lived. Gamma irradiation-induced integration of muEx184. Rescues daf-16a1/c in neurons (described in Libina et al, 2003). Reference: Zhang P, et al. Cell Metab, 2013. 17(1): p. 85-100.