More Fields
Strain Species Genotype
BN228 C. elegans bqSi210 II; bqSi226 IV. Show Description
bqSi210 [lem-2p::lem-2::GFP + unc-119(+)] II. bqSi226 [emr-1p::emr-1::mCherry + unc-119(+)] IV. Might contain unc-119(ed3) in the background. Single-copy lem-2::GFP transgene under control of lem-2 regulatory sequences and emr-1::mCherry under control of emr-1 regulatory sequences. Both transgenes are ubiquitously expressed and able to rescue development of animals without expression of endogenous lem-2 and emr-1. Reference: Morales-Martínez A, Dobrzynska A, Askjaer P. J Cell Sci. 2015 Feb 4.
BN243 C. elegans bqSi235 II; bqSi242 IV. Show Description
bqSi235 [emr-1p::emr-1::GFP + unc-119(+)] II. bqSi226 [lem-2p::lem-2::mCherry + unc-119(+)] IV. Might contain unc-119(ed3) in the background. Single-copy emr-1::GFP transgene under control of emr-1 regulatory sequences and lem-2::mCherry under control of lem-2 regulatory sequences. Both transgenes are ubiquitously expressed and able to rescue development of animals without expression of endogenous lem-2 and emr-1. Reference: Morales-Martínez A, Dobrzynska A, Askjaer P. J Cell Sci. 2015 Feb 4.
BN359 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN360 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BN46 C. elegans npp-19(tm2886) II; bqIs7. Show Description
bqIs7 [pie-1p::LAP::npp-19 + unc-119(+)]; rescues Emb defects. Rodenas et al, Dev Biol. 2009 327:399-409.
BN464 C. elegans bqSi189 II; mel-28(t1684) unc-32(e189)/qC1 dpy-19(e1259) glp-1(q339) III; ojIs1 Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C to help prevent silencing of ojIs1. mel-28 heterozygotes are wild-type and segregate wild-type, DpySteriles, and Uncs which give only dead eggs. ojIs1 is likely integrated into LG V. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from GE2622; this strain might still carry him-3(e1147) in the background. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
BN854 C. elegans bqSi294 II; bqSi852 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN908 C. elegans unc-119(ed9) III; bqSi908 IV. Show Description
bqSi908 [UAS::FLP::SL2::mNG + unc-119(+)] IV. Strain for inducible co-expression of codon-optimised FLP recombinase and fluorescent mNeonGreen by cGAL (GAL4 optimised for C. elegans). Reference: Ayuso C & Askjaer P. Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. microPublication Biology. https://doi.org/10.17912/MICROPUB.BIOLOGY.000089.
BP395 C. elegans hyEx167. Show Description
hyEx167 [4.5kb aff-1p::GFP transcriptional fusion + rol-6(su1006)]. Shows cytoplasmic GFP expression in embryonic hyp5. In L1 hermaphrodite larva, aff-1::GFP is expressed in pharyngeal muscle 3 and 5, in sheath cells of chemosensory neurons, and in tail neurons. In L3 hermaphrodites, the transgene is expressed in the anchor cell; this expression proceeds in L4 along with expression in the utse cells, the seam cells and cells of vulval rings A and D. In adults, aff-1::GFP is expressed in the sheath cells of chemosensory neurons and in head interneurons, uterus toroids 2 and 4, in the vulva VulD, utse, and seam cells. Worms of hyEx167 are slightly Egl. Maintain by picking Rollers.
BP600 C. elegans aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
BR2742 C. elegans pept-1(lg601) X. Show Description
Slow postembryonic development. Reduced brood size. Previously known as pep-2. [NOTE: the genotype of this strain was previously incorrectly annotated as lg1601. The correct allele name is lg601.] Reference: Meissner B, et al. J Biol Chem. 2004 Aug 27;279(35):36739-45.
BR2958 C. elegans ceh-16(lg16) III; jcIs1 IV; ngEx1. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. ngEx1[ceh-16::GFP]. ngEx1 rescues ceh-16(lg16) lethality. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Cassata et al. Development. 2005 Feb;132(4):739-49.
BR4006 C. elegans pink-1(tm1779) II; byEx655. Show Description
byEx655 [pink-1p::pink-1::GFP + myo-2p::mCherry + herring sperm DNA]. Pick mCherry+ animals to maintain. pink-1 translational GFP (C-terminal GFP) fusion generated by cloning the complete pink-1 genomic fragment (3191 bp) with a 6-kb upstream promoter region and into pPD117.01. Reference: Sämann J, et al. J Biol Chem. 2009 Jun 12;284(24):16482-91.
BR5082 C.elegans shc-1(ok198) I; zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836.
BR5270 C. elegans byIs161. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR5271 C. elegans byIs162. Show Description
byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR5486 C. elegans byIs162; bkIs10. Show Description
byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR5602 C. elegans tax-4(p678) III; byEx836. Show Description
byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.
BR5706 C. elegans byIs193; bkIs10. Show Description
byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR5944 C. elegans byIs193. Show Description
byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6427 C. elegans byIs194; bkIs10. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6516 C. elegans byIs194. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6563 C. elegans byIs161; bkIs10. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BRC546 C. elegans antIs30 II; unc-119(ed9) III. Show Description
antIs30 [attP-f + Cbr-unc-119(+) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. antIs30 was inserted into ttTi5605 on LG II using MosSCI. GFP expression in pharynx is very weak (as it is single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BRC566 C. elegans antIs31 II; unc-119(ed9) III. Show Description
antIs31 [attP-f + Cbr-unc-119(ant40) + glh-2p::phiC31 + rol-6(partial) + myo-2p::GFP + attP-r] II. Unc. antIS31 has been found to self-excise; check for GFP expression periodically to retain the insertion. GFP expression in pharynx is very weak (as it is in single copy) and is easiest to see during the L1-L3 stages. This strain contains a phiC31 docking site and can be used for precise single-copy integration of transgenes via recombination mediated cassette exchange. The docking site contains inverted phiC31-attP sites flanking phiC31 integrase expressed from the glh-2 germline promoter. Integration constructs need to have inverted phiC31-attB sites that flank the intended sequence to be inserted. antIs31 was derived by CRISPR/Cas9 knockout of Cbr-unc-119 in antIs30 creating ant40, a 691 bp deletion in Cbr-unc-119. Because antIs31 does not rescue unc-119(ed3), BRC566 facilitates the use of Unc-119 rescue as a selection marker for transgene insertions. Reference: Yang FJ, et al. "phiC31 integrase for recombination mediated single copy insertion and genome manipulation in C. elegans." Genetics 2021.
BS3383 C. elegans pmk-3(ok169). Show Description
F42G8.4. No obvious phenotype. Follow by PCR. Predicted gene is a p38 related Map Kinase. Approx. 1.5 kb deletion by agarose gel (not sequenced so end points not known). Nested PCR primers for detecting F42G8.4: F42G8.4EL1 5' - TCGCCCTTTGTATGTCTTCC - 3'. F42G8.4ER1 5' - TTCTCCAGGGATTAACGGTG - 3'. F42G8.4IL1 5' - TTTTCACTGCGTCTCAATCG - 3'. F42G8.4IR1 5' - TTTCAAATTTGCAGGTGTGC - 3'.
BS5633 C. elegans ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
BU7222 C. elegans pat-3(st564) III; kqEx73. Show Description
kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.
BW1118 C. elegans mel-25(ct60) unc-42(e270)/unc-23(e25) vab-8(e1017) V; lon-2(e678) X. Show Description
Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).
BW1199 C. elegans him-8(e1489) IV; unc-42(e270) sma-1(e30) V; ctDp8[vab-8(e1017)] (V;f). Show Description
BW1341 C. elegans nob-1(ct223) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; typically segregates about 50% wild type progeny and 50% Nob larvae.
BW1561 C. elegans dpy-18(e364) nob-1(ct223) unc-25(e156) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain. The Dpy and Unc phenotypes are not visible in the Nob background. ct223 is recessive.
BW1563 C. elegans pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1566 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1634 C. elegans nob-1(ct223)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT hermaphrodites that segregate WT, Dpy Steriles and Nob larvae. The Nob phenotype results in 100% lethality. Maintain by picking WT.
BW1651 C. elegans nob-1(ct351) III; eDp6 (III;f). Show Description
Animals with the duplication are WT. Animals without the duplication are Nob (NO Back end; 100% lethal). Pick wild-type to maintain; segregates wild type progeny, Nob larvae, and occasional dead eggs. ct351 is recessive.
BW1927 C. elegans pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BW1932 C. elegans ctIs39. Show Description
ctIs39 [hbl-1p::GFP::NLS::hbl-1 3'UTR + rol-6(su1006)]. Rollers. Reporter encodes the first 133 amino acids of HBL-1 followed by GFP with SV40 NLS and 1.4 kb of hbl-1 3' UTR. Reference: Fay DS, et al. Dev Biol. 1999 Jan 15;205(2):240-53.
BW2041 C. elegans pal-1(ct224) dpy-17(e164) ncl-1(e1865) unc-36(e251) III; svDp1 (III;f). Show Description
svDp1 [sur-5::GFP] (III;f). svDp1 was derived by insertion of a sur-5::GFP marker into sDp3(III;f). Pick GFP+ wild-type to maintain. svDp1 rescues ct224. ct224 homozygotes (lacking GFP expression) show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. The duplication is lost in about 30-40% of embryos. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
BX10 C. elegans ads-1(wa3) III. Show Description
Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.
BX113 C. elegans lin-15B&lin-15A(n765) X; waEx15. Show Description
waEx15 [fat-7::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
BX115 C. elegans lin-15B&lin-15A(n765) X; waEx16. Show Description
waEx16 [fat-6::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
BX150 C. elegans lin-15B&lin-15A(n765) X; waEx18. Show Description
waEx18 [fat-5::GFP + lin15(+)]. Maintain by picking non-Muv animals. These should be GFP+.
BX259 C. elegans acl-7(wa20) II. Show Description
Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.
BX275 C. elegans fard-1(wa28) X. Show Description
Deficient in synthesis of ether-linked lipids. Contains high content of saturated fatty acids. Reference: Shi X, et al. J Lipid Res. 2016 Feb;57(2):265-75.
BZ1202 C. elegans seb-3(eg696) X. Show Description
This strain is tolerant to acute treatment of ethanol. The severity and incidence of stress-induced tremors are greater than in wild-type. Reference: Jee C, et al. Genes Brain Behav. 2013 Mar;12(2):250-62.
CA1117 C. elegans dsb-1(we11) IV/nT1[unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.
CA1421 C. elegans meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CB1017 C. elegans vab-8(e1017) V. Show Description
Degenerate tail. Posterior half is thin, pale, uncoordinated.
CB1062 C. elegans daf-18(e1375) IV; vab-3(e1062) X. Show Description
Dauer defective. Notched head. Unlinked double. M-MATING-NO SUCCESS.