Chemosensory, mechanosensory, and osmosensory defects. Null allele.

Nose touch defective. Slowed response to hyperosmotic solutions. Glutamate-gated current mediated by non-NMDA type receptors decreased in the AVA and AVD interneurons.

akIs3 [nmr-1::GFP + lin-15(+)] V.

Fewer spontaneous reversals. Required for NMDA gated currents.

kbIs5 [gpdh-1p::GFP + rol-6(su1006)]. Rollers, though not obvious in all animals. Maintain under normal conditions. GFP expressed intestine and hypodermis only during hypertonic stress; not induced by other stressers. Reference: Lamitina T, et al. Proc Natl Acad Sci USA. 2006 Aug 8;103(32):12173-8.

kbIs7 [nhx-2p::rde-1 + rol-6(su1006)]. Rollers. RNAi effective only in intestine. Maintain under normal conditions. Reference: Espelt MV, et al., J Gen Physiol. 2005 Oct;126(4):379-92.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. vsIs33 [dop-3::RFP] V. References: Leung CK, et al. PLoS One. 2013 Apr 29;8(4):e62166. Leung CK, et al. J Vis Exp. 2011 May 19;(51).

vprIs108 [hlh-17p::GCaMP2.0 + hlh-17p::mCherry]. Variably penetrant backward ventral coiler. GCaMP2.0 green fluorescence is normally very low. Reference: Stout RF, Parpura V., Cell Calcium. 2011 Jul;50(1):98-108.

vprEx120 [dat-1p::DsRed(monomeric)]. Maintain by picking DsRed+ animals.

vprIs127 [hlh-17p::GFP]. Unc, backward ventral coiler.

vprIs128 [hlh-17p::DsRedExpress2]. Unc, backward ventral coiler.

vprEx133 [hlh-17p::dat-1p::DsRedExpress2]. DsRed2 expression is driven only by downstream (dat-1) promoter.

vprIs156 [hlh-17p::DsRed(monomeric)]. Unc, backward coiler.

vprIs157 [hlh-17p::GFP]. Unc, backward ventral coiler.

vprEx160 [hlh-17p::empty vector + unc-54p::mCherry]. Maintain by picking mCherry+. Unc, backward coiler.

vprEx163 [unc-54p::mCherry]. Maintain by picking mCherry+.

wyEx915 [hlh-17p::mCherry + unc-122p::GFP]. Low penetrance backwards coiler. This strain was produced by crossing TV2394 with N2 to remove wyIs45.

irIs67 [hlh-17p::GFP + unc-119(+)].

hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. mRFP targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.

hjIs73 [vha-6p::GFP::daf-22 + C. briggsae unc-119(+)]. GFP::DAF-22 targeted to peroxisomes in intestinal cells. Reference: Zhang et al., PNAS (2010) 107(10):4640-5.

hjIs8 [ges-1p::GFP-PTS1]. GFP targeted to peroxisomes in intestinal cells.

hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

hjIs67 [atgl-1p::atgl-1::GFP + mec-7::RFP]. GFP expression is not detectable at low magnification. Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

hjSi20 [myo-2p::mCherry::unc-54 3'UTR]. Targeting construct derived from pCFJ90. Single copy transgene by MosSCI, inserted into cxTi10882.

Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.

Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.

Reference: Nat Genet. 2006 Mar;38(3):363-8.

hjIs14 [vha-6p::GFP::C34B2.10(SP12) + unc-119(+)]. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.

hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.

hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3'UTR ]. Targeting construct derived from pCFJ352. Reference: Klemm RW, et al. Cell Rep. 2013 May 30;3(5):1465-75.

Reference: Zhang SO, et al. Proc Natl Acad Sci U S A. 2010;107(10):4640-5.

maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

maIs134 [lin-4p::GFP + unc-119(+)]. Wild type.

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

maIs137 [let-7p::GFP + unc-119(+)]. Wild type.

maIs138 [mir-84p::GFP + unc-119(+)]. Wild type.

maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.

maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.

Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.