| VC997 |
C. elegans |
set-4(ok1481) II. Show Description
C32D5.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC998 |
C. elegans |
dnj-7(ok1495) X. Show Description
C55B6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC999 |
C. elegans |
tag-340(ok1496) III. Show Description
F26F4.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VF14 |
C. elegans |
arIs37 I; unc-119(ed3) hmt-1(gk161) III; cdIs32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF2 |
C. elegans |
pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF3 |
C. elegans |
hmt-1(gk161) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 2,149 bp deletion encompasses exons 5, 6 & 7; introduces premature stop codon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF8 |
C. elegans |
hmt-1(gk155) III. Show Description
Hypersensitive to cadmium; refractile inclusions in intestinal cells on Cd plates. Maintain under normal conditions. 416 bp deletion encompasses exon 1; in-frame Met present in second exon. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VF9 |
C. elegans |
pcs-1(tm1748) II; hmt-1(gk161) III. Show Description
Acute hypersensitivity to heavy metals (Cd, As, Cu). Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VH1075 |
C. elegans |
rhIs4 hdIs26 III; fmi-1(rh308) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
|
|
| VH1160 |
C. elegans |
ast-1(hd92) II; rhIs4 III; hdEx237. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdEx237 [ast-1(+) + rol-6(su1006)]. hd92 arrests as L1 due to pharyngeal differentiation defects; ventral cord midline crossing defects; rescued with ast-1(+) transgene. Rollers.
|
|
| VH1195 |
C. elegans |
hdIs42. Show Description
hdIs42[ast-1::YFP + rol-6(su1006)]. GFP expression in neurons; contains full length AST-1 tagged with GFP at the C terminus. Rollers.
|
|
| VH1312 |
C. elegans |
nas-6(hd108) IV. Show Description
Slow growth. Reduced rate of pumping and abnormal morphology of the grinder in pharynx. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
|
|
| VH1348 |
C. elegans |
nas-7(hd116) II. Show Description
Superficially wild-type. Reference: Park JO, et al. BMC Dev Biol. 2010 Jan 28;10:14.
|
|
| VH1565 |
C. elegans |
rhIs4 hdIs26 III; fmi-1(hd121) V. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. hdIs26 [odr-2p::CFP + sra-6p::DsRed2] III. Ventral cord cross-over defects. PVQ axons sometimes stop short or leave the ventral cord. Reference: Steimel A, et al. Development. 2010 Nov;137(21):3663-73.
|
|
| VH17 |
C. elegans |
ast-1(rh300) II; rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Ventral cord midline crossing defects.
|
|
| VH1940 |
C. elegans |
cdh-4(hd40) III. Show Description
Partially penetrant embryonic and larval lethality. Variable morphological defects. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
|
|
| VH254 |
C. elegans |
pha-1(e2123) III; hdEx81. Show Description
hdEx81 [F25B3.3::tau352(PHP) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
|
|
| VH255 |
C. elegans |
pha-1(e2123) III; hdEx82. Show Description
hdEx82 [F25B3.3::tau352(WT) + pha-1(+)]. Maintain at 25C to select for array. Animals become progressively uncoordinated with age. Reference: Brandt R, et al. Neurobiol Aging. 2009 Jan;30(1):22-33.
|
|
| VH29 |
C. elegans |
cdh-4(rh310) rhIs4 III. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Lateral axons and ventral cord cross-over defects. Partially penetrant embryonic and larval lethality. Reference: Schmitz C, et al. Dev Biol. 2008 Apr 15;316(2):249-59.
|
|
| VH4 |
C. elegans |
rhIs4 III; zag-1(rh315) IV. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III. Hypomorph. Unc. Axon outgrowth defects and misexpression of glr-1::GFP marker.
|
|
| VH7000 |
C. elegans |
F21D5.6(hd7000[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Deletion of 964 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAAGCAGATTTTTTTCCAAAAAATGAGCT; Right flanking sequence: CGGATTCTGGTAATTTTGCAGGTTTAGTTT. sgRNA #1: GATTGATTTGGTTCCCTTCG; sgRNA #2: TTTTCTCGAATAACTCTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7001 |
C. elegans |
gna-1(hd7001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Deletion of 439 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTAACGTGTGAAATTTAGAAGCGCTGAG; Right flanking sequence: AGGAATGTGTGGAGCTAACACAGACGCATC. sgRNA #1: TCATAAAATTGCAATCGTCC; sgRNA #2: AAATTGTCAGGAAGATTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7018 |
C. elegans |
col-144(hd7006[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1165 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAACATATACATAGGTTACTACGATCCCA; Right flanking sequence: AGTAAGGTCATTCTGCGTCTCTCTTCATTT. sgRNA #1: AGAACCGCAATTACGATTAT; sgRNA #2: CAAAAGAATCTGCCGATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7019 |
C. elegans |
W10C8.4(hd7005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGTTTACAAAGTTTTAGCGGCCGACACCT; Right flanking sequence: AGGAATGATTCAAGATATATATATATATAG. sgRNA #1: TCTTATCTTAGAAACCCGCG; sgRNA #2: CTGTGTGTGAATACCAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7020 |
C. elegans |
gst-28(hd7007[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTACTGAGTATCTGGACGAGCCTCTACCCA; Right flanking sequence: CGGAAGTCCTCGAATGGAACATCTGCCAAG. sgRNA #1: CAATTCCAGCTATCAGGAAG; sgRNA #2: TTCCATCTCCGTGTGTCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7022 |
C. elegans |
ctf-18(hd7009[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7025 |
C. elegans |
F28H1.4(hd7025[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3045 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAGTTGGGTGAAAAAGATCTTGCGAATTA; Right flanking sequence: AGGGAACTGTTCGAGAAAAAATGGGACAAG. sgRNA #1: GAGGGTGATACGTACATGTA; sgRNA #2: AAGAAAATGGGGAAACACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7026 |
C. elegans |
lbp-5(hd7016[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCTGATAATAAAACTTTCTTCAAATGCG; Right flanking sequence: GGCGGGCAACAAGGTTAAACGATGGCCAAT. sgRNA #1: AACTTTCTTCAAATGCGAGT; sgRNA #2: TTTAACGTGGAAGAGATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7028 |
C. elegans |
F33D11.1(hd7023[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGAATCAAGCCCCAGTTGGCAGTCATTT; Right flanking sequence: TGGGATCTTCAACTTCGGATGATTGTTTGC. sgRNA #1: CATACAATGCCACACACGCG; sgRNA #2: GTGTTCATTCCGATTGTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7030 |
C. elegans |
F43C1.7(hd7013[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATAAAAATTAGGTATTTCAGGTTTTCCA; Right flanking sequence: GGGTTACTGTAGACGAAATGAATCCGAAAA. sgRNA #1: AACAACTTGAAGGAACTCAA; sgRNA #2: CATAAATATTAAAGCCGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7031 |
C. elegans |
dlat-1(hd7031[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1998 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGCATCGTGTGTGGCTTCTCGAGGAACTC; Right flanking sequence: TTTATCACACCGATTTTTTTTTATTTTCGC. sgRNA #1: CTTGAAGTGACGAAGCCAGA; sgRNA #2: CAAGGCGCGCGTGTTTAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7032 |
C. elegans |
npp-1(hd7032[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 3583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGGAGGGTGCCAGCAAACGCGCCCCT; Right flanking sequence: TGGCAGAAAATTGTTTTTAAAACTTATACA. sgRNA #1: CGAATTTTGTCTGTGTACGA; sgRNA #2: CTGTTTCGACCTAAGATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7033 |
C. elegans |
F36G9.3(hd7033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTTTGGGTTTCAAAATGAAGTATTTACCA; Right flanking sequence: TTTCAATATTCTCAATTCTGGCACTCATAT. sgRNA #1: TAAAACTAGACGGACGAGTC; sgRNA #2: GGATTGTGAGCACCCAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7034 |
C. elegans |
F17C8.6(hd7034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGAAGATTTTGCATTGATTTTTAGATAGT; Right flanking sequence: TGCAACCATTTTAAGATTGTTTATTTGAAA. sgRNA #1: AAAGTACACGTATGCCACCT; sgRNA #2: CCATACCATCAGGAGGCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7035 |
C. elegans |
col-176(hd7035[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1915 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGTACTTCCTTCTTCTCATGACCTCCG; Right flanking sequence: CCGGGCGGCTATCCGCCAGGCCCAAACGGC. sgRNA #1: AAAACATAGGTGGTCGGGCA; sgRNA #2: ACACAACGGCCGTCTACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7036 |
C. elegans |
ZC373.5(hd7036[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1827 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGTTTCGAAGTAATCTCAATAAAATCCG; Right flanking sequence: TGGCAAGCACTCTTGTTGTGTTGGTCTCTT. sgRNA #1: GTTCGAAGACCATTCATGCT; sgRNA #2: TTCTCTAATCTCTCCGTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7037 |
C. elegans |
arrd-15(hd7037[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 7272 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTCAAAGCATATTCCACGTACTTTAGT; Right flanking sequence: TGGCAAACCTTCAAAACTGCTCTTTTCGGT. sgRNA #1: TCTCAAATACTTCGCGTGCT; sgRNA #2: TGCTAATGAGGTCATCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7038 |
C. elegans |
T07E3.3(hd7038[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGCCAAACTTCAAAATGGCTCCATTGCCA; Right flanking sequence: CATCAGTTTAGTCTTTTTTTTTCCCAAATC. sgRNA #1: TCGAAATAACATTTCACACG; sgRNA #2: CGAGTAAAGTGCAATAAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7039 |
C. elegans |
trcs-1(hd7039[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2438 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTATAAATCAAATTAACGGAGATCGTA; Right flanking sequence: GGGAGATCAAAACGTGTTTAGAATCTTTGC. sgRNA #1: GCGAGACCCAATGCGAAATT; sgRNA #2: TTCACATTAGGCTATTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7040 |
C. elegans |
ZK512.2(hd7040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 2129 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGGCCTTTCTCTTCAAAGCCTTCTTCTCCT; Right flanking sequence: CTATGCTTTTTCTTGTATATTTCAAACATT. sgRNA #1: TGGAACTGGTAGAAAAGCAG; sgRNA #2: CATAAAATGGGTCAGAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7041 |
C. elegans |
ech-3(hd7017[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1031 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACTATGGGTGCGATTGTGGCGAATCCCA; Right flanking sequence: TGGCTGATAGAGAATCCACGTATTACTCGT. sgRNA #1: GGCACACTCGGGTTTCAAAG; sgRNA #2: TCATCCGGAAATATGCATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7042 |
C. elegans |
mpz-6(hd7015[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1556 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGACATAGTGACACGCATTGGAAGCCG; Right flanking sequence: GGGAAACTCCGCCCACAAACGCTGAAAGTT. sgRNA #1: AACTATTTCAATGGTTCAGT; sgRNA #2: CCACACTCTCCGAGCAAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7043 |
C. elegans |
mpz-5(hd7014[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATAAGAAAGTTTTTTTTTTAATTTTTAA; Right flanking sequence: ATGCCCGTTGCCATGCCGTTGTTCCGATAG. sgRNA #1: AAAGCTGTCTCACAAAGTAA; sgRNA #2: GAGGAGGAAAGGAATTAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7044 |
C. elegans |
otpl-5(hd7011[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAAATGAACAAAAAGTTACGGAGGAGGC; Right flanking sequence: ATTTCCCATCAAACTGCCTGATAGCTACTC. sgRNA #1: GAACTCCCACCCTCCCTTAA; sgRNA #2: CCAAAGTTCAATTCAGTAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7045 |
C. elegans |
cal-3(hd7045[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 6270 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACGTACGTTATACGTAATAGAAGCACGTG; Right flanking sequence: CTCGGGGCGAATTCAAATAAAGATGCGGCT. sgRNA #1: CGTAATAGAAGCACGTGAGA; sgRNA #2: CGCAATTTGATCACACTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7046 |
C. elegans |
ubc-1(hd7046[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGGAGTTAGGTTATCAATATGACGACGCCC; Right flanking sequence: TGGAAATTGAAGAAATTGCTGCTCCAGGAG. sgRNA #1: CTCATCAAACGTCTACGGCT; sgRNA #2: CGCAGTGCTCAAGGATGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7047 |
C. elegans |
gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7048 |
C. elegans |
gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7049 |
C. elegans |
efl-2(hd7049[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGCTCGAGGGGCTCGGTTATGTGGAGA; Right flanking sequence: GGGCTTACCATTTTGTGGGCGTGGTTAGCT. sgRNA #1: GCTCGGTTATGTGGAGAAGG; sgRNA #2: CACAAAATGGTAAGCCCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7050 |
C. elegans |
sknr-1(hd7050[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAGACCCGGCAAAGAAACAAAGATTATC; Right flanking sequence: GCATGGCATTTCATCAAGAACAAAGAGATA. sgRNA #1: AAGAAACAAAGATTATCGTG; sgRNA #2: TTGATCGTGACTACATGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|