More Fields
Strain Species Genotype
UL6 C. elegans leIs6. Show Description
leIs6 [vha-8::lacZ + rol-6(su1006)]. Rollers. This strain shows B-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The second component to this expression pattern appears to be localized in the hypodermis adjacent to the excretory canals. B-galactosidase was seen in the nuclei from late embryogenesis through to the adult. plasmid name: pUL#64A1. Partial Sau3A fragments cloned into BamH1 site of vector. Plasmid backbone: pPD22.11. A 2.7 Kb HindIII fragment from the insert of pUL#64A1 hybridized to YACs Y55E11, Y53F3, Y50C9, and Y73B6 which overlap on LGIV. References: Young JM, Hope IA. Dev Dyn. 1993 Feb;196(2):124-32. Hope IA, et al. Mol Gen Genet. 1998 Nov;260(2-3):300-8.
UP148 C. elegans sem-5(cs15) X. Show Description
Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.
UTR43 C. elegans par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. Show Description
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html
VC14 C. elegans rap-2(gk11) V. Show Description
C25D7.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1498 C. elegans cap-2(ok1929)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1640 C. elegans dcap-1&Y55F3AM.13(ok2139) IV. Show Description
Y55F3AM.13, Y55F3AM.12. External left primer: AAATCAGGGAAATATCGGGG. External right primer: TTTTCCAGGGTAAATCACGC. Internal left primer: GTCGTCGGTTTGCATTAGGT. Internal right primer: ACGTGGGAGACCAATCTGAC. Internal WT amplicon: 2730 bp. Deletion size: 1252 bp. Deletion left flank: AGCTTCTGGAGCATTGGCGGCATTTGTTCG. Deletion right flank: TTCCTACTTTTCCCAGCCAAATCGCTTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2270 C. elegans lap-1(ok2917) III. Show Description
ZK353.6. External left primer: GATGTGTGTGGTCAGCTCGT. External right primer: ACCAACGAGGATGCAGTTTT. Internal left primer: CGGGACAATTACTGTTTGAGC. Internal right primer: ATCTCTCAGAATCGGTCCGT. Internal WT amplicon: 1129 bp. Deletion size: 331 bp. Deletion left flank: ATTGAATTGAAGTTAAATATACTTTGCAAT. Deletion right flank: CCAGCCTTCAACAGTTCTTCCCCACGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC230 C. elegans vap-1(ok392) X. Show Description
F11C7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC333 C. elegans tap-1(gk202) X. Show Description
C44H4.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3737 C. elegans rap-3(gk3695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.
VC4302 C. elegans mcm-3AP(gk5385[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
F20D12.2. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4523 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCGCTCGCCAGCCGTCTCACGGTTCCTTCA. Right flanking sequence: CGATGATAATCTTTCCGATTTACTGTATTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4469 C. elegans sap-49(gk5542[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5010 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1365 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGACTAATTAGTTTTGGTGTGTCCTCCG. Right flanking sequence: GACGTTCCCGAATCAACATCTCTCATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4642 C. elegans rpap-2(gk5711[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1761 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTCGAAAATGGTGGCCGCGTGGCCGAAC. Right flanking sequence: TGCACGCTGCGATTAAATCCCAATGTTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4892 C. elegans trap-1(gk5960[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1169 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TGAAGCTGTCGACCGTCTTTCTTCTCGCCG. Right flanking sequence: TTCTAAAAAATATATAAAAATCAATAAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC582 C. elegans +/mT1 II; pgap-2(gk285)/mT1 [dpy-10(e128)] III. Show Description
T04A8.12. Homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, sterile Dpy-10 mT1 homozygotes, arrested mT1 aneuploids, and gk285 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC680 C. elegans gap-2(ok1001) X. Show Description
ZK899.8a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC774 C. elegans dohh-1&dap-3(gk347)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C14A4.1, C14A4.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT relatively dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk347 homozygotes (L4 to young adult arrest, often bursts at gonadal placque or vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7166 C. elegans ncap-1(hd7160[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZW304 C. elegans lin-15B&lin-15A(n765) X; zwEx124. Show Description
zwEx124 [unc-7ap:GFP + lin-15(+)]. Pick non-Muv to maintain. Reference: Altun et al. Dev Dyn 238:1936-50 (2009).
AA278 C. elegans dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
ABR339 C. elegans lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
AC196 C. elegans sao-1(ik1) V. Show Description
Superficially wild-type. Suppresses of aph-1(zu147). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AC68 C. elegans unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs.
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AD281 C. elegans spe-45(as38) IV; him-5(e1490) V. Show Description
Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055
AD292 C. elegans spe-51(as39) IV; him-5(e1490) V; asEx95. Show Description
asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
ADS1002 C. elegans aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
ADS707 C. elegans unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
AE501 C. elegans nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
AF13(4) Oscheius akosreti Oscheius akosreti wild isolate. Show Description
Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C.
AF8130 Pristionchus sp. Show Description
Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.]
AG150 C. elegans apc-1(ar104)/unc-4(e120) bli-1(e769) II. Show Description
Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.
AG152 C. elegans unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
AG226 C. elegans rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
AH1747 C. elegans unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
AH1779 C. elegans unc-119(ed3) III; zhIs38 IV. Show Description
zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
AH75 C. elegans apr-1(zh10) unc-29(e1072) I; zhEx11. Show Description
zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array.
AM141 C. elegans rmIs133. Show Description
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.
AP36 C. elegans mep-1(ok421)/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02.
APL31 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
AS270 C. elegans gly-12(id47) X. Show Description
Phenotypically WT. F3.2 See also WBPaper00005927.
AS271 C. elegans gly-14(id48) III. Show Description
Phenotypically WT. M8ns. See also WBPaper00005927.
AU133 C. elegans agIs17 IV. Show Description
agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86.
AU78 C. elegans agIs219 III. Show Description
agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
AUM1863 C. elegans sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
AV125 C. elegans spe-8(hc40) I; dpy-4(e1166) IV. Show Description
Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy.
AV221 C. elegans unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
AV267 C. elegans syp-3(me42)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.